Labels

Harp (107) Vaughan's (70) Erp_Earp_Earpe (69) Vaughan (40) VAUGHAN DOCUMENTATIONS (21) Photo source (20) Source (20) Johnson (19) BOHANNON (17) Vaughn (17) LIST OF PROGENITORS R (15) TODD (14) Civil War (13) LIST OF PROGENITORS S (13) Land Records (13) Photo (13) Graves (12) LIST OF PROGENITOR B (12) Stone (12) MORROW (11) Calicott (10) Census (10) Vaughans (10) LIST OF PROGENITORS H (9) BARNES (8) LIST OF PROGENITOR M (8) FISHER (7) FREE GENEALOGY SITES (7) Genealogy Blogs (7) LIST OF PROGENITORS P (7) List of progenitor C (7) Looney (7) Wills (7) BLOCHER (6) HICKMAN (6) Fraley (5) GREEN (5) Henderson (5) LIST OF PROGENITORS V. (5) Parker (5) Roller (5) Tax List (5) Tucker (5) Turner (5) VAUGHAN Y-DNA TESTS (5) Buchanan (4) Calico (4) Davis (4) FANNING (4) GENEALOGY LIST; W (4) LIST OF PROGENITORS G (4) Lynch (4) REV. WAR (4) Sanders (4) Workman (4) Affidavit (3) BARRETT (3) Benton (3) COAT OF ARMS_SHEILDS_CHREST (3) DNA Research (3) DOSS (3) Fitch (3) HAMMON (3) INDIAN LINE (3) Kappen (3) LIST OF PROGENITOR F (3) LIST OF PROGENITOR Vaughan's (3) LIST OF PROGENITORS D (3) LIST OF PROGENITORS L (3) LIST OF PROGENITORS M (3) LIST OF PROGENITORS N (3) LIST OF PROGENITORS T (3) LISTS OF PROGENITORS T (3) List of progenitor A (3) List of progenitor T (3) Pinkley (3) Ryves (3) Smith (3) Soldiers (3) WELCH (3) Webb (3) Wyatt Earp (3) Arp (2) BIGELOW (2) BRANHAM (2) BUTLER (2) Book (2) Bouldin (2) Brumley (2) CLARK (2) CLIFTON (2) CUPP (2) Deeds (2) Evans (2) Fanny (2) Ford (2) GODARDS (2) HALL (2) Harris (2) Jackson (2) LIST OF PROGENITORS J (2) LIST OF PROGENITORS K (2) LIST OF PROGENITORS O (2) LOWE (2) LOWMAN (2) Lane (2) List of progenitor J (2) List of progenitors W (2) MAP (2) MOORE (2) MORSE (2) Minor (2) Mock/Mauk (2) NEEDS (2) NOWLIN (2) Obituary (2) PUBLISHING GENEALOGY (2) Pensions (2) REEVES (2) Records (2) SHERMAN GENEALOGY (2) SPAULDING (2) SPENCER (2) STINNETT (2) STOUT (2) Shelton (2) Taylor (2) VILLINES (2) WILLIAMS (2) https://shermsgenealogyconnections.blogspot.com/ (2) AAD ARCHIVES (1) ADAMS (1) ADE (1) ARCHER (1) Anderson (1) BAKER (1) BARBER (1) BINGHAM (1) BIRD (1) BOGARDUS (1) BONE (1) BROWN (1) BRUNSWICK (1) Bell (1) Bevers (1) Bilyeu (1) Booth (1) Booton (1) Bouldinge (1) Bowlen (1) Boyd (1) Breeden (1) Bromley (1) Brooks (1) Broyhill (1) Burchfield (1) CALLICOTT (1) CAPPS (1) CEMETERY (1) CLINKENBEARD (1) COOK (1) COX (1) CRAFT (1) CULL (1) CURRENT (1) Canterbury (1) Comments/questions (1) DAVID (1) DAWSON (1) DICKIRSON (1) DIVORCES (1) EDDIS (1) ENGLAND (1) EPPRIGHT (1) FAIRBANKS (1) FARR (1) FEEZELL FERGUSON (1) FLANNERY (1) FORMAN (1) Funeral Notices (1) GAWKROGER (1) GLASSCOCK (1) GUTHRIE (1) Genealogy list Worlow to Wynkold (1) Grindstaff (1) Guthrie (1) HAMMER (1) HARRISON (1) HOLMES (1) HOWEY (1) HUDSON (1) Harper (1) Harrison (1) Hoftman (1) Ivie (1) JANSEN (1) Johndon (1) KENTUCKY (1) LAIRD (1) LAWSON (1) LAY (1) LEGG/LEGE (1) LINCOLN (1) LIST OF PROGENITOR E (1) LIST OF PROGENITOR V (1) LIST OF PROGENITORS I (1) LIST OF PROGENITORS U. (1) LISTS OF PROGENITORS R (1) LORD (1) Lewis (1) Litteral (1) Lost Persons (1) Luten (1) MARRIAGES (1) MASON (1) MAYCOCK (1) MC CLOUD (1) MILLER (1) MOLYNEAUX (1) MUSTAIN (1) Mcaninch (1) NEEDHAM (1) NEWSOM (1) NEWSPAPER (1) NEWTON (1) Name List; Yager to Zuldy (1) ODAM (1) OSBORNE (1) OWENS (1) PACE (1) PENNEBAKER (1) PLOCHER (1) POINDEXTER (1) POOLE (1) PRATT (1) PRESCOTT (1) PROGENITOR LIST OF J (1) PROGENITORS C (1) PULLEN (1) Parry (1) Patent Rec. (1) Pugh (1) R (1) RADCLIFFE (1) REINHARDT (1) RHODES (1) RIPLEY (1) RUSSELL (1) Recipes of Ancesters (1) Rotledge (1) SCOTLAND (1) SEATTLE WASHINGTON LIBRARY (1) SEQURA (1) SHEPHARD (1) SHOEMAKER (1) SHRESBURY (1) SKINNER (1) SNAPP (1) SPIER (1) STEBBUBSM (1) STELLE (1) STONEKING (1) SURRATT (1) Salmon (1) Scott (1) Sharp (1) Sims (1) Sullivan (1) Svein Torbjornsen Austara (1) TEFFETELLER (1) THOMPSON (1) TIM CHILDRESS SITE (1) TRETOWER (1) Thorn (1) Troutt (1) Twist (1) UK ARCHIVES (1) VAN DEURSEN (1) VAN SCHAICK (1) VAWN (1) WADE (1) WAGNER (1) WARREN (1) WEAVER (1) WHALE (1) WHITE (1) WHITEHEAD (1) WILBORN (1) WILCOX (1) WILLARD (1) WILSON (1) WINKLER (1) WISHONG (1) Wagner (1) Weems (1) Wesson (1) Wilkie Whelchel (1) Winn (1) Wright (1) YANKEY (1) Young (1)
Showing posts with label VAUGHAN Y-DNA TESTS. Show all posts
Showing posts with label VAUGHAN Y-DNA TESTS. Show all posts

MORE DNA NEWS ON VAUGHANS

RE; NEWS: The Vaughan DNA site which our Vaughan's are a part of -- it continues to be updated with new DNA data, though there are no new additions to the 'Turquoise Group' which is our DNA type at the site, or the 'Green Group' which is the DNA of Ben Vaughan. Our Tuquoise group is the largest Vaughan group in the Vaughan DNA study and we are probably the most 'together' of the various groups. Our Turquoise group also is the only group on the site that has non-Vaughans included, though others would do the same if they were as 'together' as we are in finding information.
Aside from the fore-mentioned 'Green Group' our VP group is also responsible for several entries in the 'Orange Group' when we ran tests to see if Abraham Vaughan was related to our guys (and he wasn't).

 Ben Vaughan does not have William and John's Y-DNA but has instead the Y-DNA of Willards.  Many of you share in the desire to find out as we need to know if Ben himself was a son of a Willard or if it wasn't him at all but was James Vaughan who was the son of a Willard man.
 
It seem it was James who was the Willard, as there were Willards living close to the Callicotts in Prince Edward County, VA not too long before James was born, but can't prove this or disprove it without finding DNA samples of James and Martha's other sons to compare agains Bens' Y-DNA. 
 
 
If James' other sons match Ben's Y-DNA, that would mean either all of James sons were adopted or, much more likely, that James' Y-DNA was not the same as John's Y-DNA, and thus Nancy Callicott either had James by a Willard man before marrying John, or else John and Nancy adopted a Willard baby -- which is unlikely as Nancy was pretty young when she married John. (Would  a 'kid' know enough to raise another person's child when (at the time?) She had not even had one of her own yet.
 
Results for Ben's Y-DNA test came back some years back and they were not R1b1 like John and William's, but were R1a.  what happened? Where did this generation new genetic link come in?

RE: Eddie Davis Group of Genealogist
PHOTO: ROBERT WOODROW VAUGHAN

All comments are most welcomed!

VAUGHAN LINEAGE THEORIES

Y-DNA CAN PROVE, CONFUSES and RAISES MORE THEORY'S IN GENEALOGY RESEARCH

"When Lewis Vaughan wrote "Vaughan Pioneers" he did not feel -- at the time-- confident enough to put Martha Vaughan in his outline as a daughter of William and Fereby as there was no solid documented proof of her existence, mostly just stories from the Ben Vaughan line about her. And in the book, Ben Vaughan was listed, but as a mystery on how he fit in. From personal letters back and forth to Lewis before his death and after viewing letters he sent to others at the time he was writing Vaughan Pioneers, he felt that Ben's mother was a daughter of William and Fereby, and that his father was James Vaughan, son of John and Nancy. He also agreed with my theory that John and William were brothers.''

''What Lewis never lived to see was the discovery that Ben's descendants' Y-DNA does not match William and John's. And as William Vaughan and John Vaughan have matching Y-DNA they were absolutely genetically related, and could certainly have been brothers, (but this does NOT mean that they were, only that they could have been), it means that Ben Vaughan or James Vaughan, one of the two, was not a genetic descendant of John Vaughan.''

ALSO; (theory) ''Martha's age is older than James. What if Martha had a relationship with a Willard boy and came up pregnant. For whatever reasons, the Willard boy did not step up to the plate and marry her, and so the family didn't know what to do. Martha perhaps had been living with the Willard boy (she was 28 years old when Ben was born) for several years, without marriage. William approaches John and Nancy Vaughan and they set up an arranged marriage between the older Martha and her cousin, James. James agrees, but is not at all pleased with the situation. After Ben is born, James grows more and more restless, has a couple of kids with Martha, then finally leaves them in Arkansas and heads to Texas.''

''BUT -- ...about the age thing -- 28 years old when Ben was born. And there is another unknown Vaughan in the mix -- David Vaughan, born about 1810, who could also have been Martha's son. He was living with Daniel Vaughan in 1830 in Washington County, AR, but apparently wasn't his son due to stuff in his will. If he was indeed an OLDER brother to Ben Vaughan, then Ben's Y-DNA results are even more problematic as either 1. David Vaughan, if he was James and Martha's son, would have James' Y-DNA, or 2. If he was only Martha's son, by the same father as Ben, then that would hint that Martha had been married to another man, yet both boys had the surname Vaughan, either taking their mother's maiden name or else being adopted by James Vaughan.''
........................
''We really don't know for sure how David Vaughan fits in, he may not be Martha's son.''
''There is also some hint and something far darker in the family too -- something that may have been buried so far back in the closet that only hints of it surface from time to time. I've heard a few scattered hints that there could have been some incest in William Vaughan's family, but never anything such as stories, mostly just odd findings that researchers have made that could be confused records. Some have speculated that maybe William had molested either a daughter or granddaughter. Now obviously, if he had conceived a child with his daughter, the baby would have his Y-DNA, so he could not have been Ben Vaughan's father. But I wonder if maybe Martha fled home due to this molestation and "shacked up' with any local man who would have her and 'protect' her from her father. Perhaps Martha had David by her father in 1810 and she moved in with a Willard man, whom she had Ben with in 1815, only to then marry her cousin James.''
''If this was the case then the genetic record would reveal:''
''1. ) David Vaughan would have his father's (William Vaughan) Y-DNA, which would also match James Vaughan's.
2.) Ben Vaughan would have his Willard father's Y-DNA, a mismatch to William and James.
3.) All of Martha and James' male children would have James' Y-DNA, which would also match David's, but not Ben's.''(Now we know why incest is such as sin...it mess up genealogy lines here and here-after.)
''Confusing, and purely speculation, but as others have shown, something doesn't add up. Mistakes on census records are not at all uncommon, and guessing ages is also not unusual. The 1830 and 1840 census seem to show the same female that we have speculated could have been Martha, and Ben would have shown up on the 1820 census with his mother and probably the 1830 census too. But family tradition and Ben's own words state he went to live with William and Fereby as a child. This would cast serious doubt on the Incest theory, as who would let their son go into a house that you fled from a few years ago? I seriously doubt there was any Incest in the family, thank God. And why did just Ben go to live with his grandparents? Why didn't his younger brothers that Martha had by James go as well? And where was Maborne
Washington County, Arkansas 1830 Census
Line 6
Daniel Vaughan
w/m 05-10 years=1 -- His son Zimri b. abt 1821
w/m 10-15 years=1 -- his son Isaac b. 1818
w/m 20-30 years=1 -- unknown, possibly David Vaughan, but this child's birth years would be 1800-1810, wrong for Ben Vaughan
w/m 40-50 years=1
w/f under 5 yrs=2
w/f 05-10 years=1
w/f 10-15 years=1
w/f 15-20 years=1
w/f 30-40 years=1
Conclusion is Ben was not living with James or with his uncle Daniel in 1830. So what about Samuel Vaughan could he be there?
Samuel Vaughan
w/m 15-20 years=3
w/m 50-60 years=1
w/m 70-80 years=1 -- THIS would be WILLIAM VAUGHAN
w/f 40-50 years=1
w/f 70-80 years=1 -- THIS would be FEREBY BENTON VAUGHAN
''This was where William and Fereby were living in 1830, and so this would be a logical place to look. Samuel had three sons; Defsy, born about 1809, who DIED ABOUT 1825, George W. Vaughan "Judge Vaughan" born about 1813, and Andrew Jackson Vaughan, born about 1815. Since Defsy was dead in 1825, there is an extra boy in the 15-20 male category. Is this Ben Vaughan, living with his uncle and grandparents? But why was he not living with his mother and his younger brothers? It seems as though Ben was somehow separated from the others. Yet family stories speak of Ben's brothers, "Lige and William". William is thought to have been living with Ben in 1840 in Madison County, AR.''
1840 Madison Co, AR – Prairie Twp
p. 31, line 3 Benjamin Vaughan 20002-10011
male b. 1810-1820 Benjamin (20-30) b. ca 1815
male b. 1810-1820 unknown (20-30) poss. brother, William, b. ca 1817 ..... female b. 1810-1820 Cherubia (20-30) b. ca 1817 female b. 1820-1825 unknown (15-20) possible sister-in-law, Rebecca, b. ca 1820 female b. 1835-1840 Mary Narc. "Sis" ( u 5 ) b. ca 1838 male b. 1835-1840 Geo. Wash. ( u 5 ) b. ca 1839 male b. 1835-1840 unknown ( u 5 ) possible a nephew, Francis M., b. ca 1840 Elijah was living with his Mom, Martha in Huntsville, AR, in 1850.
..................
Martha and Elijah show up in 1860 too: 1860 Huntsville, Madison County, Arkansas 1016/1016 E C Vaughan 27 Merchant, born in Tennessee Mary F. 18 born in Arkansas Martha A. 60 born in "IND" -- either Indiana or Indian Territory? In 1870 Martha was living with Ben and Cherubia in Clifty, Madison County, Arkansas, listed as being 83 years old and born in Virginia. 1870 Madison County, Arkansas -- California Twp. #14 Benm Vaughn 54 m fmr $1000/500 TN Cherribee (sp) 51f can't write Dallis 24m AR Mary 18f Martha Vaughn 83f VA The 1870 census record is one source for Martha's birth date of 1787, but notice she should have been 73 on the 1860 census. Unless there were two Marthas. One theory is that James Vaughan was married to two Martha's? The first was Ben's mother, born 1783, then he divorces her and marries Elijah and William's mother, born abt. 1800. The question is, if William "Bill" Vaughan F. was born about 1817, was he the first Martha's son or the second? Freddie Todd claimed that Ben, William and Maborne were full brothers but John and Elijah were by a second wife of James. from "The Vaughans" by Mickey Weise Vaughan p. 1 "One of Benjamin's grandchildren thought perhaps he had a brother named Bill and another named Lige. She remembers a conversation from her childhood in which Ben was asked, "How come you're a man of the world and got good boys and Bill is a preacher and got such mean boys?" Ben answered, "Well, I was called and Bill answered." So if James married twice, it is possible that they are two Martha Vaughans on the 1860 and 1870 census. But where was Ben's Mom before 1870, if that is not her on the 1860 census. It is also possible that Maborne, Ben, William (and maybe David) were all Martha's sons by the same man (maybe a Willard?) and perhaps she didn't marry James in 1814 but later, say about 1820. James adopts the boys, giving them his surname (and ironically, their mother's maiden name) of Vaughan. The marriage doesn't last and they divorce, Ben goes on to Arkansas. On the 1829 Sheriff' s Census for Washington County, Arkansas, a boy in Benjamin's age bracket (about 14 or 15) appears in William Vaughan's household. (This data from The Arkansas Family Historian, Volume 14 ,1976, page 170). I'm not sure the 1830 census record that Helen posted is in fact for our James Vaughan. If it was, there are several sons of James not listed in my records: 1830 . M. F. 2 Under 5 This means 1825-1830, only shows John, born 1827 as a son. 2 5-10 1 This would be 1820 to 1825, I know of no sons born in this time frame? 1 10-15 This would be 1815 to 1820, and we have both Ben, and Maborne in this category. 1 30-40 1 I've also seen this listed as our James: 1830 Warren County, Tennessee Census, it is believed he appears at homestead # 374 374 James Vaughan 211001-012001 Males: 2 Under 5, One 5-10, One 10-15, none 15-20, none 20-30, one 30-40 this doesn't really fit either. Anyway, I just wanted to point out some of the big mysteries we still are facing in our research." Quoted and the works of Eddie Davis ec21davis@sbcglobal.net

(I know I'm confused! but, respect Eddie's work.I recommend reading the book 'America B.C." by Barry Fell if you are at all interested in learning about the evidence of pre-Colombus Europeans (and other cultures as well) travelers/migrants to the Americas that very likely could have contributed to this odd DNA connection to Native Americans) AND look at the referrers at the bottom of the pg.

..........................................................
..."Some past searches have given credence to census records that have more negatives than positives while not attending records that match. According to analysis--assumptions made, based on these records, may be wrong-right. Searches, if made ONLY on these assumptions, end up with the same questions and no answers. Proven data: Born in Halifax VA, 1795, James L. Vaughan lived in Hawkins Co. TN in the home of his parents until abt 1815. When he was abt 20 yrs old he left Hawkins with his 28 yr old bride, Martha Patty and her parents, William and Fereby Vaughan. Three sons, Benjamin Franklin, and perhaps twins, Maborne and William, were born to them and show up on the 1820 White County, TN census with all ages matching. Problem: 1. Martha Patty Vaughan’s age—born 1787. She is 8 yrs older than James L. Eight years is a lot of years to miscalculate or ignore on future 1830 and 1840 census forms, but maybe miscalculated or ignored. 2. Statement: JLV’s son Benjamin Franklin’s claim that he was “raised” by his grandparents William and Fereby Vaughan. After 1820, he went to live with his grandparents, probably at his own choosing, and being only 5 or 6, cld rightly claim they raised him. 3. Freddie Todd’s claimed, Ben had 2 bros and 2 half bros. Which half did John and Elijah, b. aft 1820, belong to? – James L. or Martha Patty? A logical explanation wld be that 1. Martha Patty had a daughter 2. with another James Vaughan and 3. lied abt her age. All three of which would be necessary to make the census of 1830 and 1840 true for Martha Patty. Similar changes would have to be made to make them true for James L. Neither can be true for the folks listed on the 1820 census. 4. 1820 Census. Future census records do not match this same family unit, esp. regarding the 8 yr discrepancy in Martha and JLV’s ages. On later forms (1830 and 1840) there is a female child added to research w/ no explanation. 5. The background of the name of Maborne. (Product of a variant script, perhaps?) 6. Where wld “parts unknown” be in 1841, as stated by James L. Vaughan’s father? Answer: Not anywhere that there were family members who evidently kept in touch with one another, like from Western TN, MO, or ARK. Only Texas. 7. Perfect matches of Texas history with JLV’s whereabouts, his massive land acquisition, and his military and census records. 8. Other Vaughan family connections in 19th century Texas w/JLV and associates. 9. There are as many different James Vaughan/Vaughn s as there are John Vaughan/Vaughn s and seemed to be mixed and matched just as casually. Conclusion: Of the dozens of James Vaughan/Vaughn’s tracked, there is only one James L. Vaughan b. 1795 VA, and he was in Texas at least from 17 Oct 1835 to 1860. Why not look at James L. Vaughan and for his son, Maborne and wife Lucinda in Texas? Maybe he even remarried and left a whole new gene pool of Texas DNA to be discovered. I may not be up to date on the research that I reviewed, but it is clear that others do not yet know that on perfectly matched records from 1835 to 1860, and probably beyond, there is a lot of James L. Vaughan, born 1795 VA, in Texas." Antonymous (It's clear we researcher need to ask the questions to get the right answers...if ever possible.)

Thanks for your corrections and additions to these posts. All comments are most welcomed! Site Meter

Corrections: VAUGHAN LINES

Informational Materials are from three E-mail comments: I can't mention names but they may not want to make them public?
James L. Vaughan did not name his son after the old Revolutionary hero, but instead, after his little brother his father named for, - his old war hero, just as he did another son in 1820 after the new nation s first president. Also Benjamin W. Vaughan is on the wrong side of the mountain in the 1840 census, and plain old Benjamin Vaughan is on the right side, right where his mom and dad's records recorded.”
“...Get the book, "Vaughan Kin" in Grayson Co., TX to search for Anderson and the twins, Jacob and John descendants? We have lots of John Vaughan descendants in North Texas.” (Nice to know because this can be confusing if we don't realize this problem.)
“TWO BENJAMIN VAUGHANS OF HAWKINS CO TN, born; 1805
In the January 1985 Newsletter, pge. 2, Johnette Franke and Mabel Harp indicated that John & Nancy Callicott Vaughan's son Benjamin married Martha Simmons.
In the Jan. 1988 issue, pge.3, Verna Banes tentatively stated that James Vaughan's (b. 1767) son Benjamin W. married Eva Everheart (1834, Hawkins Co TN). Now we know those assumptions was incorrect. Through intenstive research by Mabel Harp, Naomi Hopperstad, Mary Gregg, Alice Wineinger, & others; It has been decided that these two Benjamins (both b. 1805) have been reversed.
Were they cousins?”
“The main proof is that one is always referred to as Benjamin W. (Walker), and the other as Benjamin.
Benjamin W. is listed in the 1840 will of James (b. 1767). References to these families will be found in Newsletters pp. 17 & 25, 1984, p. 18; 1986; p. 51, 1987; and p. 3, 1988 issues.” (Remember to check census too i.e., data is only as correct as those who put them into the papers or any document.)
“An undocumented source states that wife of James (b 1767) was Elizabeth Walker. Therefore it seems logical that the Benjamin Walker Vaughan would have been their son. James' will names widow Sally. Did he have two or more wives?” (...or, wrong person here?)
If facts are correct, Benjamin (wife Eva Everheart) was the son of John and Nancy Callicott Vaughan; while Benjamin Walker (wife Martha Simmons) was the son of James and Elizabeth Walker Vaughan.”
“Children of Benjamin Walker and Martha (Martheir) Simmons Vaughan were:
Lucinda, b. 1829, m. David D. Anderson (Derrick).
Samuel S., b. ca 1832, m. Sarah. Benjamin W., b. ca 1834.
Robert Arnout, b. 1841. Martha, b. ca 1843, m. Jordon H. F1etcher(?).
_*NAOMI LONG HOPPERSTAD, 1224 Otto Blvd. #1, Chicago Hts. IL 60411 is the great-great grand- dau of Lucinda & David Anderson. She joins Verna Banes and others (see pge. 3 of the January 1988 issue) who descend from James Vaughan born 1767.”
http://vaughan-vaughn.org/verna/1989/89-pg81.htm
..............................................................................................................
Re: Two Benjamin Vaughans of Hawkins/Hancock County Y-DNA
''...male descendant of Ben to compare my Ben Vaughan's Y-DNA against. His Ben would have been Ben and Eve's nephew and if biologically the elder Ben's nephew, then they would have the same Y-Chromosome DNA. The Elder Ben should have either John (and William) Vaughan's Y-DNA, or my Benjamin Franklin Vaughan's Y-DNA, which is totally different than John and William's Y-DNA.”
“Since Ben and Eve had at least 3 sons, this gives us a fair chance at finding a direct line male descendant...”
“I think the son of John and Nancy Callicott Vaughan is Benjamin Franklin Vaughan--not Benjamin Walker Vaughan.” (I agree)
..."why I think the son of John and Nancy Callicott Vaughan is Benjamin Franklin Vaughan--not Benjamin Walker Vaughan."
….......................................................................................
More quoted E-mail All in quotes...
“In 1815 James L. Vaughan named his son, Benjamin Franklin Vaughan. I assumed, I think correctly, that he named him after his younger brother. Most likely John Vaughan named his third son after a Revolutionary War hero who helped save him at Valley Forge with food, clothes and guns wrangled from the French, and his son, James L., was most likely was honoring a little brother, not the revolutionary old man his father knew.”
“Since that first assumption, I have seen Benjamin Walker Vaughan’s name linked to John Vaughan’s third son and then, some of Ben’s nephews and other kin with the name of Franklin. A few days ago, I found the mix-ups.”
“Sorting thru the chaff of Ancestry and using history to find kin, Is this story. Everyone knows by now how important stories are to my research. Its facts are backed up by: census, 1841 will, 1858 pension claim and Revolutionary War data. Also the confusion may have been helped by the fact that down the road a descendant of Ben Walker V. married Nancy Vaughan Hickman’s daughter or granddaughter, Ann, bringing his name into the John Vaughan clan’s records. I hope that this will clear up and help out Vaughan research. The bold notations in italics are mine and made to help out my research; the unmarked story’s address is at the end. Don't know the author:''
Eve Everheart
Eve Everheart was born ca. 1803 on Dodson's Creek in Hawkins County Tennessee the daughter of Jacob and Catharine Everhart. On September 6, 1834, Eve was married to Benjamin Vaughan in Hawkins County."
"Ben Vaughan was born November 4, 1805, in Western Hawkins County the son of John Vaughan and Nancy Callicott. In ca. 1799, his parents had come from Virginia and settled North of the Holston River in the part of Hawkins County that would later become Hancock County. (See Revolution story, SGT John Vaughan….)"
"In 1836, Eve and Ben's first children, twin sons, were born. They were named Jacob and John A. after their grandfathers, Jacob Everhart and John Vaughan. On November 28, 1839, another son, Anderson W. was born."
"In 1841, Ben Vaughan's father, John, died and left Ben a portion of his land on the north side of Clinch Mountain. In 1844, it became part of the newly created Hancock County. (See John Vaughan Will, 1841)"
"When the census taker came in December 1850, the Vaughan family was living in the 32nd subdivision of Hancock County near the village of Kyles Ford. Nearby neighbors included Eve Everhart Vaughan's nephew, Jacob Brotherton and his family; Eve's sister and brother-in-law, Mary and Beverly C. Ford and children; and two of Ben's brother's families, John and Susan Vaughan and Samuel and Melvina Vaughan. (Beverly Ford, desc. Of Dicey Callicott Vaughan Ford, widow of Ligon Vaughan. Also, Ben’s sister Nancy Vaughan Hickman and family are in this census, and in their midst is James Jones, b. abt 1824 TN who cld be the mysterious baby entered in Nancy Callicott’s Daybook) This census was taken on the side of the MT. Benjamin lived on. That same year there is a Benjamin W. Vaughan listed on the other side where Ben’s parents moved in the 1830’s. (See Nancy’s 1858 pension claim and father’s 1841 will.) There is a Benjamin W. Vaughan, married to Martha Simmons on the other side of Clinch Mt in 1840 where John and Nancy had moved abt 1830."
"On November 8, 1851, following a revival held in a brush arbor by the pioneer preachers Asa Routh and W. A. Keene, a group met in the home of George Anderson and organized the Independence Baptist Church of Hancock County. Ben and Eve Vaughan were among the thirty-four charter members. Ben's brother, John Vaughan and his wife Susan, and Ben's sister-in-law Melvinia Vaughan were also there. (See George Anderson in Nancy’s pension files; a Justice of the Peace)"
"Later a meeting house of large prime logs was built at the foot of Looney's Gap in Clinch Valley on land donated by N. M. Moneyhum and his wife. Since Mr. Moneyhum was a Methodist and his wife was a Baptist, it was agreed that both demoninations would use the building. (Search religious history and churches. The Moneyhums are in census. )"
"Ben and Eve Everhart Vaughan and their sons John A. and Anderson W. have not been found on the 1860 census. Their son Jacob Vaughan was living with his cousin, William Ford, in Hancock County when the census was taken.(William Ford, desc of Dicey Callicott Vaughan Ford)"
"All three of Ben and Eve Vaughan's sons appeared on the 1861 Grayson County Texas Personal Property Tax List, and Jacob Vaughan was also listed in 1862, but Benjamin Vaughan's name does not appear until 1863. (Date is compatible with Ben’s 1858 affidavit for his mother’s pension claim. Nancy died at the end of Sept 1858.)"
"Ben and Eve Vaughan had probably left Hancock County by the time the 1860 census was taken and were probably in route to Texas. The date of their arrival has not been established, but on July 12, 1862, "Brother Benjamin Vaughan and wife Evy" were received by transfer of letter into the Kentucky Town Baptist Church at Kentucky Town, Texas.**. (See Ben’s 1858 affidavit in mother’s pension claim. Also, he had land to sell.) "
"The village of Kentucky Town had been established in ca. 1852 in southeastern Grayson County. Eve's brother James B. Everhart had settled nearby in ca 1846, and her brother Emanuel had come from Alabama in 1848 and purchased several tracts of land near the future site of Kentucky Town. In 1860 another brother, Jacob Everhart had also settled near Kentucky Town, so the Vaughan's had settled in a community with East Tennessee relatives living nearby. (See Ben’s nephews, Samuel Alexander[GWV], William[SNV], GWV[SNV], and others; perhaps he even associated with brother James L. Vaughan in South Texas. [See 1858 pension affidavit in which Ben knew James had gone to Texas.] (Furthermore, KY Town was settled in part by future Vaughan in-laws: the Chaneys of Bowling Green, Kentucky, some of whom may have been in Hawkins Co, and who had fought in the Revolution there. (See Sgt. John Vaughan… )"
"Ben Vaughan's name appeared on the Grayson County Tax List for 1863 and 1864, but we believe that the land for which he was taxed actually belonged to his son Anderson. The 1864 Tax List is the last record found for Ben Vaughan."
"When the 1870 Grayson County census was taken, Eve Vaughan, age 66, was living with her son Anderson W. Vaughan in the 3rd District."
"Eve Everhart Vaughan died before 1880 (probably in 1875). Her funeral was preached at the Kentucky Town Baptist Church by the Reverend J. W. Connelly, and she was buried in the Batselle Cemetery near Kentucky Town, Grayson, Texas. Ben Vaughan was also buried there, but stones for them have not been found."
Post Note: ** From "Kentucky Town and Its Baptist Church" by Joe W. Chumbley, 1975. D. Armstrong Co., Houston, TX"
http://trees.ancestry.com/pt/EditStory.aspx?tid=307240&pid=-796214544&pg=0
"A few items about Benjamin & Eva Vaughan's family.
Benjamin (45) & Eva (47) are listed on the 1850 Hancock Co, TN census withtheir 3 sons, Jacob (14), John (14) and Anderson (12). Also listed areJohn & Susan Vaughn, Samuel & Melvina Vaughn, Mary Church (Malvina's mother?), and B. C. & Mary Ford. In 1860 their son, Jacob Vaughn (25) is living with Wm. & Susan Ford still in Hancock Co, TN. Unable to locate the rest of the family in 1860.
On USGenWeb cemetery listings for Grayson Co, TX, Batsell Cemetery(without the "e" at the end) is listed as aka Pitman's Chapel Cemetery or Camp Ground Cemetery. The following are listed in Batsell Cemetery:
Anderson Vaughn Mrs. Vaughn both d. 1883. Note says: info from Pastor's notes on the funeral. (There are some Everhearts buried there as well..."
"Also in Grayson County, Texas in the Preston Bend Cemetery were their allied families the Edwards and the O'dell's (spelled Odell). They were all camped out there waiting for the Oklahoma Territory to open up. When OK opened up, you will find the Edwards in Thackerville, Texas (Thackersville is present day Oklahoma town spelled both with and without the "s") if you look on the map, they will be spread from Thackersville then east to Tishomingo, all before 1910 census in Carter, Love and Johnston Counties OK. You will also find some of them in Denton Co Texas around 1980."
Thanks for any corrections and additions to these posts. All comments are most welcomed! Site Meter

Y-DNA FEREBY VAUGHAN LINE

Y-DNA- The mystery of William and Fereby Vaughan has intrigued descendants for over 100 years. Several books have been written on them and their descendants. This is meant to give a brief update on research into their ancestry.
(DNA can be done on any line. Here one site to start http://www.familytreedna.com/Default.aspx?c=1)
Here's a short biography of William and Fereby, both were born about 1750, though personally believe Fereby was born several years afterwards. Family tradition says William was born in Wales and lived close to Tretower Castle. According to family tradition, he came to the USA sometime before 1773 and settled in Virginia.
Fereby Benton was born in North Carolina. It could be possible that she was born in Tennessee when the state was still part of North Carolina. Family tradition says that she was part Cherokee, on her mother’s side. Her father, tradition says either married the daughter of a Cherokee Chief, or was himself a Chief. Her mother was said to have been a Fereby Looney or Luna, who died in childbirth with Fereby. She was obviously named for her mother.



Around 1772 William Vaughan married Fereby Benton. Their oldest known child, Thomas, was born the following year. They lived in Russell County, Virginia, then moved to Hawkins County, Tennessee. After staying there several years, they moved again, to mid Tennessee and maybe Southeast Missouri, before coming to middle Arkansas around 1821. They traveled to Arkansas with at least two of their sons and their families and several daughters with their families. Tradition says they settled somewhere around Short Mountain Creek near Paris, Arkansas, just south of the Arkansas River. They didn’t stay here long, and then moved northwest to the Boston Mountains of Northwestern Arkansas. Cane Hill and Evansville are said to have been their homes and then, once the Cherokee Indians had been moved to Oklahoma, eastward to around Hindsville, Arkansas. A mountain bordering Washington and Madison Counties is named Vaughan Mountain and a valley to the east of the Mountain is where Hindsville is located. They lived with their children during these years. On land still owned by descendants, William and Fereby are said to have been buried, though no gravestones were placed over their graves. William died sometime in the late 1830s and Fereby died in May of 1850, for her death is listed on the 1850 Madison County Death Schedule. She is listed as having died at age 105, which is at least 7 years too old.
Family Tradition: Since researching ancestors before 1850 is challenging due to a less abundance of records, much of our knowledge of William and Fereby comes from Family Tradition. One tradition is that William was a Longhunter who traveled in Colonial times with the likes of fellow Longhunters such as Daniel Boone, to the Ozark Mountains, years before he moved his family there. Another legend is that Fereby’s maternal grandfather was Chief John Looney. This is ridiculous, as Chief Looney was BORN AFTER Fereby.
One could spend many hours going over the traditions that have been passed down, two will be examined. First, that Fereby was part Cherokee Indian and second, that William Vaughan had a brother named John who married Nancy Callicott. Both of these traditions were given new insight by DNA testing.
DNA
To understand how the DNA results work, you must have a basic knowledge of genetics.
Deoxyribonucleic acid (DNA) is the chemical inside the center of all cells that carries the genetic instructions for making life. DNA molecules have two strands that wrap around one another and look like a twisted ladder. The “rungs” of the letter are called bases and there are four types of chemicals that make up all types of DNA. These are Adenine, Thymine, Cytosine and Guanine (or A,T, C and G). These chemicals are attracted to each other and Adenine always pairs with Thymine and Cytosine always pairs with Guanine. The sequence of these chemicals determines everything about an individual.
Chromosomes are long packages of long segments of DNA contained within the nucleus of each cell. All humans have 23 pairs of Chromosomes. In 22 pairs, both sides or parts of each pair are identical, one each coming from the father and the mother. But the 23rd pair is different. In females, this pair has two chromosomes that are called “X”. In males, this chromosome has an “X” and a “Y” which are two very different chromosomes. These Chromosomes determine a person’s sex.
MtDNA
There is another type of DNA that is different from nuclear DNA. It is called Mitochondria DNA ( or MtDNA for short ). MtDNA is DNA that acts as the engine of every cell in the human body. It is not part of the “regular” type of DNA and never is mixed during reproduction. MtDNA is passed down intact from a mother to a child of either sex. Men do not pass their mother’s MtDNA to their children. Since it is not mixed during reproduction, MtDNA can be thought of as a genetic fingerprint that can show a person’s mother, maternal grandmother, great grandmother, and so on back through your mother’s line. (Could this be why the SEALING of children are never taken from the mother? Preserving their role as pro-Creator with God for eternally. One reason women do not need the Priesthood role.)
Y-Chromosome DNA
Y-Chromosomes (Y-DNA for short), as mentioned above, are the Chromosomes that only males have, which makes “maleness”. As they are passed down intact from father to son, they also can be thought of as a genetic fingerprint, that can show a person’s male ancestry.
How can either MtDNA and Y-DNA show a genetic link if these two types of DNA never mix with other DNA? This is due to mutations.
When MtDNA or Y-DNA sets up its genetic code, it follows patterns that it setup for itself. These patterns consist of repeating orders of chemical code in each section. For example, say in “Section A” on a strand of Y-DNA, the Chemicals form an ATCGATCGATCGATCGATCG code. This is ATCG repeated 5 times. If there was a mutation, one of the repeats might be taken out or another repeat added, and the value would become 4 or 6. Then this would become the DNA value for that section of genetic code. This mutated DNA would then be passed down to the man’s male children. These mutations in repeats are not harmful and don’t really change anything noticeable. They are also very uncommon and happen completely at random.
Scientists have learned that all human beings alive on earth descend from two ancestors. They gave the names of these two people (not surprisingly) Genetic Adam and Eve. All the diversity of Y-DNA and MtDNA types today are the result of mutations over the years changing the number of repeats in a person’s code. Certain groups would become isolated from other groups and so different patterns of code would occur. Today, Scientists can tell approximately where a man’s father’s male ancestors lived and where a person’s mother’s female ancestors lived by looking at the type of Y-DNA and MtDNA.
The identifiable physical location on a chromosome that scientists look at is called a Locus. There are many Loci in a DNA strand, and only a few Loci are looked at. Tests range from examining 12 loci to 37 loci. Each loci is given a value as a number, which shows the number of times a pattern of chemicals repeats itself.
The rate of mutation of any specific locus of DNA varies. Some loci are more likely to mutate than other loci. The average of all the rates is .002 %. This rate is not without some debate among scientists. What this rate means is, on the average, any given marker has a .002 % chance of mutating (changing the number of repeats) in any generation. If I have a value of 12 in one loci and my son has a value of 13, then that loci (assuming I’m looking at Y-DNA) has mutated. Sometime the DNA mutates more than one number, such as going from 12 to 14 at one loci. This is very uncommon, however, and most of the time, a mutation is a simple one step mutation.
The rate of mutation doesn’t sound very high and in fact, it isn’t high at all. But the more markers you look at, the more likely it will be that a person will have at least one mutation. When you multiply this by many generations, you greatly increase the odds. Also, when you are comparing two people that share a common ancestor over 200 years in the past, then you have twice the chance of a mutation from that common ancestor, as there are two different lines.
As a result of several years of Y-DNA and MtDNA research, a growing database of test subjects has been organized. Patterns of code based on where a person lives has developed, showing that in limited populations, specific mutations are passed down due to the lack of contact with other populations of people.
Using probability math, a percentage chance that a person shares a common ancestor with another person, and the number of generations (or less) that this occurred, has been calculated. If you test 12 markers and 10 of those 12 markers match another person’s markers, you have a 50% chance that the two of you share a common ancestor 61 generations back, a 90% you share one 122 generations back and 95% chance you share one 144 generations back. For a 11 out of 12 match, it is 50% for a common ancestor 37 generations back, 90% for one 85 generations back and 9%% that there was a common ancestor 10#=3 generations back. The numbers for an exact match of 12 out of 12 goes 50% of a common ancestor 14 generations ago, 90% chance this was 48 generations ago and 95% chance it was 62 generations ago.
For 25 marker tests, a 23 out of 25 match means you and the one you were tested against have a 50 % chance that you share a common ancestor 28 generations ago, a 90% it was 56 generations ago and a 9%% chance it was 66 generations ago. 24 out of 25 matches show a 50% it was 17 generations ago, 90% it was 40 generations ago and 95% it was 66 generations ago. Remember, a generation means the length of time for a child to grow up and have children. Saying this is about 20 years, then 17 generations is about 340 years.
Lastly (and most importantly for our Vaughan Y-DNA study), if you have tested two people and they match 25 out of 25 loci, there is a 95% chance these two people share a common ancestor 30 generations (about 600 years) ago, 90% it was only 23 generations ago (460 years) and a 50% chance it was only 7 generations (140 years) ago. As you can see, most people want to test more loci and a better match narrows down the number of generations.
The Results of this study
Our first test conducted was not on Y-DNA but on MtDNA from a member of our on-line Vaughan Pioneers Group, Kim Grabbard. Kim descended through her Mom’s, Mom’s, Mom’s, Mom’s, Mom’s, Mom’s, Mom from Fereby Benton. Our test was to see if Kim and thus Fereby’s MtDNA would show that Fereby’s mother was of Indian ancestry. Native Americans have specific types of MtDNA and if this type shown up in Kim, then Fereby would have been confirmed that she was part Cherokee. As all the family traditions of Fereby say her mother was the source of her Cherokee Indian blood, we knew that if this was true, then it should show up in her MtDNA. After waiting for the test results for 6 weeks, we learned that Fereby Benton’s mother had the most common type of MtDNA from Northern Europe (Haplotype H), so Fereby’s mother couldn’t have been a pure blood Cherokee and neither was Fereby. It only shown the lack of Indian blood in one of Kim and Fereby’s ancestor, it didn’t prove anything else. Fereby’s father or her father’s father could have been Indian and since MtDNA is passed down from mother to child, she wouldn’t receive any Indian MtDNA from him. MtDNA only shows one person’s ethnic type, but if Fereby’s mother had been 100% Cherokee, she would have passed down to Fereby a Native American Haplotype. If her mother was any degree less than 100% Indian, she could have passed down a European Haplotype, but realistically, it probably shows she wasn’t Indian at all, at least on her mother’s side. I state this due to the time frame involved. Fereby was born about 1750. Her mother would have been born no later than the mid 1730s. If her mother wasn’t at least half Indian, then the timeframe would make it more difficult for her to have an Indian ancestor, due to more limited intermarriage with the Cherokee Indians before the 1730s. However, if Fereby’s mother was half Indian – her mother a white woman and her father a Cherokee (or some other tribe), then Fereby’s mother would have received white MtDNA from her white mother and in turn passed it down to Fereby. So Fereby could have been a quarter Indian and still have white MtDNA.




William and John Vaughan
In 2004, we decided to try a test on a descendant of William Vaughan and a descendant of John Vaughan. John Vaughan is a name that pops up often when looking over William and Fereby’s ancestry. He first shows up as a Revolutionary War soldier, serving in the Maryland Artillery. He achieves the rank of Sergeant and after his discharge, moves to Virginia. It is in Charlotte County that he meets 14 year old Nancy Callicott. Though he is 15 years older than her, they fall in love and try to marry in October of 1792, but apparently her father would not allow it. So they wait until she turns 17 and they elope to Halifax County and are married there. Here they stay until 1798 when they move to Hawkins County, Tennessee. The land they buy in Hawkins County was near land owned by William and Fereby and years later as they are preparing to move west to central Tennessee, William sells land which is resold to John and Nancy. John and Nancy’s son James marries William and Fereby’s daughter Martha. James and Martha move west with William and Fereby and pass down a tradition that they (James and Martha) were first cousins, their fathers being brothers. John and Nancy die in what later became Hancock County, Tennessee. The Y-DNA test would show if a descendant of William and a descendant of John shared the same Y-DNA.
Fortunately, we found two test subjects. Both men were direct male descendants of William and John. Both had to have the last name Vaughan. We had long suspected that William and John were brothers, and reckoned that our two test subjects would have to have a close match of Y-DNA if their ancestors were brothers. The time frame for this test was from about 1762 when John, the youngest, was born and modern day. A period of 242 years. We were hoping that their DNA would give us a 23 or better match. I suspected there would be about 2 mutations due to the many generations between them. This is very common. We had Family Tree DNA in Houston, Texas conduct the tests, as they had done our earlier MtDNA test. The results we received electrified us. Both men had a perfect 25 out of 25 match, showing a common male ancestor. There was a 50% chance that ancestor was 7 generations back of both men. One man was only six generations down from whoever was William’s father. The other man was 7 generations removed from the father of John Vaughan. The earliest common ancestor would have been born about 1730 if not earlier, so in 274 years, neither men had mutated in even one spot from the other man. It is very likely that both John and William Vaughan were brothers or at the very least, first cousins. They definitely had a common Vaughan ancestor and when taken with the tradition in some branches of the family that they were brothers, it only confirms it.
William and John’s Y-DNA values:
Locus DYS # Alleles
1 393 13
2 390 24
3 19 (also known as 394) 14
4 391 11
5 385a 11
6 385b 16
7 426 12
8 388 12
9 439 12
10 389-1 13
11 392 15
12 389-2 30
13 458 17
14 459a 9
15 459b 10
16 455 11
17 454 11
18 447 25
19 437 15
20 448 19
21 449 29
22 464a 14
23 464b 15
24 464c 16
25 464d 17
William and John’s parents
Using the information we gathered from the DNA test and comparing it to family tradition as well as searching early records – can we make any statement as to who were the best candidates for the parents of William and John?
After spending many months looking at what data is available for early Virginia Vaughans, I have found that the best candidates for William and John’s parents are Abraham Vaughan and Ann Bouldin of Charlotte County, Virginia.
While it is easy to simply state this, reaching this conclusion is not without some warnings. First, for this theory to work, John and William are assumed to have been brothers. This was very likely the case, but it can not be proven by any official documents from their time frame. Also, I had to accept that William was not born in Wales like family tradition holds he was, but instead was born in Virginia. Again, no proof either way, but years of research makes me feel he was not the original immigrant.
So who was Abraham and Ann (Bouldin) Vaughan?
A brief biography.
An Abraham Vaughan begins appearing in the area that would become Charlotte County in 1749. There was actually an Abraham who lived in Amelia County and received land in 1746 on Saylor’s Creek (525 acres) who may be the same man as Ann’s husband, but research still continues on this, so we will begin by looking at the Lunenburg land grants.
Lunenburg County was quite large when it was formed, but as more settlers began moving to the area, new counties were formed. The location of the land that Abraham and other Vaughans owned was located by using a Topographic map. The first grant is in Lunenburg County on September 5th, 1749 for 400 acres. The Grant mentions John Twitty as a neighbor and as the location as “a branch on the 2nd fork of the Lickinghole”. Lickinghole creek has not been identified, but from other grants and deeds, it is known that this was around the town of Saxe in Charlotte County.
In Lunenburg County, Virginia records, there is the estate of John Sullivant (Sullivan) who died in 1755.
On page 147 is this: “Account Current of the estate of John Sullevant, deceased.
Debits. To paid: Mr. Thos. Boulden; Wm Goode; Wm Newsum; James Breedlove; Jos. Chandler; Abr. Vaughan for rolling 2 hogsheads of tobacco. 1754. To paid: Clem't Read; funeral charges; the appraisers; for finishing the crop.” This is no doubt Abraham Vaughan.
In the “George Washington Papers” there is a letter from Clement Read of Lunenburg County, Virginia, dated March 15th, 1757. The letter was to General Washington at Williamsburg. He says that 26 Catawbas Indians lead by their Chiefs “Capt. French or French Warrior” and “Capt. Butler” came to march to see George Washington in Williamsburg. Clement sent them to Washington and sent Robert Vaughan to escort them on the journey east. 5 days later, 93 more Catawbas with their “King” or Principal Chief “Haglar” came and wanted to see Washington too, so Read sent Robert’s brother ABRAHAM VAUGHAN to escort this group. The letter also mentions that the Indians are fond of the two Vaughan brothers. As there is a strong tradition of William Vaughan being a Cherokee trader, this story seems very interesting. It can’t be proven that this was the same Abraham that married Anne Bouldin, but I suspect he was, and if so, then he had a brother named Robert.
In 1760, a John Vaughan receives a grant for 400 acres “On both sides of Reeces Fork of Twitty’s Creek”. Another grant for an additional 404 acres was granted to him at around the same time. It is possible that this John was a cousin of Abraham. John appears in Grants and other records in Charlotte County, his wife was Elizabeth.
There were apparently some other Vaughan families in Charlotte County in the time frame I am looking at in this booklet. Names like James, Robert, John and Joshua, as well as Thomas and Benjamin, appear as witnesses to Deeds of neighbors, or as both grantors and grantees of land. Some if not all may have been relatives, maybe brothers, nephews or cousins. Right now, not much data on these Vaughans, and we can’t make a case for or against them as candidates for John and William’s father.
Abraham appears in Lunenburg County Deed Book 9, page 226 as “Abraham Vaughn of Lunenburg & Parish of Cornwall”. Cornwall Parish later became Charlotte County. In this deed, Abe conveyed to Joseph Friend of the same county the land “whereon Vaughn lives” “180 acres on both sides of Twittys Creek together with 100 acres.” Abe then bought land from William Conner.
On August 15, 1764, Abraham Vaughan received another grant on “the head Branches of Horsepen Creek adjacent to his own lines.” This was for 400 acres. As it mentions his land already owned, it indicates that this land was the grant of September 5th, 1749. Horsepen Creek is less than a mile south of Twitty’s Creek. The following year, Joshua Vaughan receives a grant of 400 acres on both sides of a branch of Sanson’s fork of Horsepen Creek. This was very close to where Abe’s land was located. It is unclear who this man is and how he is related to Abraham. Vaughans appear in various court documents over the next thirty years. Sometimes only the last name is mentioned. Where there is a location given, we can see that many of the records refer to Vaughans living in a different part of the county. A James Vaughn (no second “A” in the name) witnessed the sale of land owned by James Foster of Nottoway Parish, Amelia County, for land in Charlotte County. It is not clear if the witnesses lived in Amelia or Charlotte County.
On November 1st, 1769, John Vaughn of Nottoway Parish, Amelia County sold to Robert Vaughn Jr. of Amelia County 400 acres in Charlotte County on both sides of Reeses Fork of Twitty’s Creek. It mentions the land was granted to John in a patent dated August 12, 1760. A witness was a James Vaughn. So John who patented the land lived in Amelia County, as did Robert, to whom the land was sold. Over the next 10 years, the land apparently was in legal red tape, as in 1770 there is mention of the transfer and how Elizabeth, John’s wife was unable to come to the county courthouse to relinquish her dower rights on the land.
On March 23, 1771, a William Vaughn (no second “A” in Vaughan) of Charlotte County bought from Benjamin Clements of Charlotte County, 100 acres of land on the branches of Horsepen Creek. It was bounded “by the lines of Frank and Vaughn”. The witnesses were Sherwood Walton, Abraham Vaughn and Thomas Chaffin. Jean, Benjamin’s wife relinquished her right of dower.
Then on September 6th, 1774, Abraham Vaughn sells some of his land. Here is the text of the sale: From Abraham Vaughn of Charlotte Co. To John Lindsay & Co., Merchants in Glasgow, for 127 pounds/ 11 shillings a certain tract of about 400 Acres of land in Charlotte Co. On the branches of Horsepen Creek adjoining the lands of James Speed, John Moore, & Robert Belcher, being land on which the said Abraham Vaughn now lives, upon trust that Lindsay shall, after 25Dec1775, sell the land and premises, and out of the money arising from such sale, discharge the dept. Signed: Abraham (X) Vaughn. Wit: Philip Moncrieff, Alexander Burt, William Clark, Robert Cuninghame. The deed of trust was rec: 1 May 1775. Deed Bk. 3, P.514 65 Glasgow could have been a town in Virginia, not the foreign city.
He and his wife Ann witnessed the will of Thomas Bouldin, who was suspected as a relative of Ann's: Charlotte County, Virginia Will Book 1, page 334:
Thomas Bouldin elder Will May 1 1777 Prob 2 June 1783
Son James Bouldin 400 acres. Daughter Fransena wife of John Cox. Sons Thomas Bouldin negro Jacob, William Bouldin 390 acres on Meherrin River and slave Pitt, Joseph Bouldin 720 acres in Henry Co and slave Sam. Children of my daughter Marry. Sons Wood and Richard Boulding. Exec sons Wood and Richard Bouldin.
Wit: James Cuninghame, Sarah Collier, Abraham Vaugn, Ann Vaughn, Robert Gilliam, Thomas Cox.
Security Reverent Thomas Johnston and Joseph Collier.
Abraham appears on a 1782 tax List for Charlotte County. Also appearing is a William Vaughan and no other Vaughan. To appear, you had to be 21 years old or older.
Finally, in Charlotte County Will Book 2 page 83 is the will of Abraham Vaughan as follows:
In the name of God amen, I Abraham Vaughan of Charlotte County being in my perfect sense and memory tho week in body do constitute and make this my last Will and Testament. First , I direct that all my just debts be paid and duly discharged. Secondly that my son William Vaughan be paid out of my Estate one Shilling. Thirdly that my son Felix Vaughan be paid out of my Estate one Shilling. Fourthly that my son Bolling Vaughan be paid out of my Estate one Shilling. Fifthly that my son John Vaughan be paid out of
my Estate one Shilling. Sixthly that my son Lewis Vaughan be paid out of my Estate one Shilling. Seventhly that my Daughter Milly Smith be paid out of my Estate one Shilling. Eighthly that my Daughter Sally Mahany be paid out of my Estate one Shilling. Ninthly that my Daughter Nancy Childry be paid out of my Estate one Shilling. Tenthly I lend to my wife Ann Vaughan during her natural life the plantation that I now live on, all my Negroes
(namely) Poll, Dilly, Jacob, Bill, John Jackson and Julius also all my Horses, Cattle, Hogs, and Sheep. Together with all my Household and Kitchen furniture and plantation utensils. Eleventhly after the death of my Wife Ann Vaughan, I will and direct that my daughter Molly Vaughan be paid out of my Estate thirty pounds and a good Cow and Calf in case their should not be personal estate sufficient to raise the above legacy given to my
Daughter Molly Vaughan. I direct that a sufficient quantity of land whereon I now live be sold to pay the same legacy. The remainder of my Estate both real and personal after the death of my Wife Ann Vaughan I give and bequeath to my two sons David Vaughan and Bailey Vaughan to them and their heirs forever to be equally divided. In witness whereof I have hereunto set my hand and seal this eighth day of May in the year of our Lord One thousand seven hundred and ninety five.
Signed in the presence of Abraham ( X ) Vaughan
E. Boulden, Wood Boulden
At a Court held for Charlotte County the 4th day of January 1796 this Last Will and Testament of Abraham Vaughan dec'd was presented in Court and the same was Proved by the oath of Epharin Boulden and Wood Boulden the two Witnesses hereto subscribed and ordered to be recorded.
Of course, E. Boulden and Wood Boulden are sons of Thomas Bouldin who was related to Ann, Abe’s wife. Sometime before January 4th, 1796, Abraham Vaughan died. But Ann and her daughter Sally McHaney at around the same time that Abraham wrote his will, witnessed the will of Jonathan Read. For in Will Book 2 on page 79b, on December 1, 1795, appears Jonathan’s will. It was probated the same time that Abraham’s was, January 4th, 1796. This will names only a brother-in-law, John Lewis, his brother Thomas Read and a son, John Lewis Read. Why would Ann and her daughter appear as witnesses to the will instead of the usual male neighbor? This is a mystery that's no explained.
One of the last mentions of Abraham in records is from about 7 years following his death. The will of Karon Bayne in Lunenburg County mentions land “lying in Charlotte County on the Horse Pen Creek and formerly belonging to Abraham Vaughan, deceased.” This is in Will book 6, page 52 of Lunenburg County.
Suspect that a Ligon Vaughan who married Dicey Callicott, daughter of James Beverly Callicott (the father of Nancy Callicott) was a son of Abraham and Anne. They married on January 15th, 1789 in Charlotte County. But Ligon died sometime in 1792 and James Beverly Callicott received permission to act as administrator of his son-in-law’s estate. Dicey later remarried on December 26, 1793 to William Ford. They moved to Hawkins County, Tennessee. This Ford family was very likely the same family that Nancy Ford, wife of Thomas Vaughan (son of William and Fereby) came from, though I’m still trying to prove this.
As Ligon died before his father did, and as Dicey remarried, neither one was mentioned in Abraham’s will. So what became of Abraham’s other children and what happened to his land? These two questions are of great importance to me and at the time of this writing, I am still trying to find these children in Charlotte and neighboring counties. Bailey Vaughan died sometime between 1795 and 1798 and his share of the land goes to Molly Vaughan, his sister. Bailey doesn’t leave a will, but Molly in turn dies in late 1798 and does leave a will (Will book 2:146b). She names her son Archer Vaughan and “property entitled by the death of my brother, Bailey Vaughan.” She leaves this land to her son. There is no mention of a husband, so the son was probably born out of wedlock. Clement Read was appointed guardian of her son, Archer Vaughan.
This leaves William, Felix, Bouldin, John, Lewis, David, Milly, Sally and Nancy.
Felix and David don’t show up in marriage records for Charlotte County, so they may have died or moved. Lewis married Mary Childrey on November 23, 1801 in Charlotte County. Nancy married Jeremiah Childress on November 5th, 1792 and these two spouses may be related as their names are very similar. Bouldin married Susannah Fuqua on June 1st, 1790. Sarah “Sally” married Perry Mahany or McHaney (or other spellings) and appeared with her mother in the will of Jonathan Read. Mildred or “Milly” married Benoni Smith on March 8th, 1789.
This would leave Abraham’s two sons, John and William. There were at least two John Vaughans in Charlotte County in the 1790s One married Betty Mullins on June 9th, 1794. The other applied for a marriage license in Charlotte County on October 5, 1792, but the ceremony wasn’t performed. This second John was John who married Nancy Callicott.
One William Vaughan married Martha “Pasty” Mimms on September 23, 1781. I’ve been trying to learn who this William was – was he Abraham Vaughan’s son or from another Vaughan family? The Bondsman for this marriage was a James Vaughan, which makes me think this marriage was to a different family, as there was no James Vaughan in Abraham’s family at the time. This William lived in Charlotte County for the rest of his life. He served in the Revolutionary War after enlisting on February 5th, 1776 in the 4th Regiment commanded by Colonial Isaac Read. He was born about 1850 and lived past 1830. I suspect that James Vaughan, who appears in Charlotte County in the 1770s, was this William’s father. In order to eliminate them as possibilities of William and John’s father, these other Vaughans need to be researched closely.
If all the marriages in Charlotte County that are listed above occurred when the people were in their early 20s, then most of them would have been born in the 1770s. But many of the men had served in the Army during the Revolutionary War and came back slightly older then married.
So research goes on in finding the parents of John who married the Mullins and William who married the Mimms. Until it can be established who these men’s parents were, there is a reasonable doubt that Abraham and Anne could be the parents of our William and John. Unfortunately, there are not many Charlotte County documents available to clear up this confusion. I’m currently trying to track down what became of the land that Abraham owned. There are many questions and this will keep the hunt for William and John Vaughan’s ancestry alive for many years.
It may be obvious that much of the connections presented are very difficult to “prove”. Sadly, this is the case. Before 1850, Census records were not very informative. Not everyone wrote wills, so quite a few people don’t appear on documents. Deeds are often not very informative on who the participants in the Deed were. Colonial newspapers in Virginia are very rare. Tax Lists usually only contain the name of the tax payer and not who is living in his home. Add to all of this a rapidly changing county structure in Virginia, where a family could, within 5 years reside in 3 or 4 different counties without moving, as well as poor clerical spelling on documents leading to mixed up names, and you will see that trying to find a Vaughan family in this time frame can be rather difficult.
There were, as best as I can tell, three Abraham Vaughans living in the overall general area where the husband of Anne Bouldin lived. All three were related.
Abraham Vaughans
The first one was a son of Richard and Alice Vaughan of Prince George County. This Abraham was born around 1710-1720 and married to a woman named Loveday and was the father of 7 children. He lived in Brunswick County and died in 1748, leaving a will. One of these 7 children was Abraham Vaughan Jr. He lived in Brunswick County. The first Abraham is obviously not our Abraham for numerous reasons. Abraham Jr. was probably too young to have been our guy, so we can rule him out.
The Abraham who married Loveday was a son of Richard Vaughan who was in turn a son of William Vaughan (1625-1695) who was, I suspect, the son of a John William Vaughan who came to Jamestown on an early supply ship and was the first Vaughan in America.
William (born about 1625) had 6 known sons and one daughter. One of his other sons was Nicholas Vaughan, born about 1685. This Nicholas was a brother of Richard who’s son Abraham is presented above.
Nicholas Vaughan lived on 169 acres of land in Prince George County then he and his wife Ann (Lewis) Vaughan moved to south of Petersburg. Nicholas and family apparently moved to Amelia County sometime in the 1730s. Here he died in 1738. His son Abraham was young enough that a guardian had to be appointed. Robert Hicks was appointed Abraham’s guardian in December 9, 1738. His mother, Ann, remarried Henry Fitz in August 1739.
This Abraham was born on March 16th, 1721. On January 12, 1746 he patented 525 acres in Amelia (now Prince Edward) County on the lower side of Sayler’s Creek. He is on the tithable list in Amelia County and is shown as between Flat and Deed Creeks between 1746-1748. In 1749 he moved to Lunenburg County and sold his 525 acres to Thomas Vaughan, his brother, on December 21st, 1750. The wife of Abraham Vaughan is given as Mary. It is the mention of Mary as his wife that messes up a theory that Abraham Vaughan who married Anne Bouldin was the same man as this son of Nicholas. It could be that Abraham was married twice and that sometime between 1750 and the time of his death, Mary died an Abe married Anne.
Regardless of whether our Abe is the same man as Nicholas’ son or not, we see an Abraham Vaughan in 1758 on the Colonial Militia list for Lunenburg County. In 1764, a Abraham Vaughan bought land onTwitty’s Creek in Lunenburg County from Manoah Sullivan. Manoah was the brother of James Sullivan who was the father of Ann Sullivan the wife of Nicholas Vaughan.
In 1764, Abraham appears again in Lunenburg on the Tithe list. There is a gap between 1752 and 1764 of records in Lunenburg County due to court fires destroying some of the records. The area in 1764 where Abe appears is the part of Lunenburg that would, the following year, become part of Charlotte County. So an Abraham Vaughan appears in Lunenburg County records on 1748, 49, 50, 58 (militia list) and 64. The same man as Anne’s husband? Nicholas had a son named Robert, so this would match the data in the George Washington Papers.
Blogroll
Vaughan DNA study web page
Vaughan Pioneer page -- Rootsweb
Vaughan Pioneer Yahoo Group
Vaughan Pioneers Research Group page
Vaughan/Vaughn Resource Page
Author of Genealogy: Eddie Davis has a great web page and group check them out for yourself if your a Vaughan cousin. Mr Davis has these charts on CD $10.00 and a book of Welsh Vaughans $30.00 625 S Miller RD Springfield, MO 65802 (ec21davis@sbcglobal.net) He know a lot about this subject, and is as follows;
http://www.tretower.com/
There is certainly much more work to do to sort through the many records and confusion of names. I hope this booklet has presented some data and helped the reader to see the focus of Vaughan research.
http://www.therooms.ca/archives/pdfs/panel3.pdf is the URL of a page that shows some of the brothers of Ted Vaughan's great grandfather -- all these men share these Vaughan's Y-DNA exactly, and all lived in Nova Scotia. It could be, if we could find Ted's ancestors back before they came to Nova Scotia, we might have a link to where our Vaughans lived, and the line they descended from.
THERE ARE Wales Project and several others. This is their main site http://www.genpage.com/walesdnaproject.html
Their Data files is located at, http://www.familytreedna.com/ftGroups_score_frame_classic.aspx?pass=xbiqHi2DKjFhgZ3PuO%2b41%2bfM6Ma2nXS01tkG0Iak5PURMftastABJRltynkXrpki13Eq6IXMBs6Odx7hi8nczK8MLXfGMapt6GnLm0dwILLnGzqTlAP%2bjEq5ZFgJKqkefwdP2bTjZRA%3d
or use this link, http://tinyurl.com/585lal
Thanks for sending this to us through the e-mail for all of us Vaughan cousins. (I copied and paste well!!)
Updates: http://www.mediafire.com/?mqxojdwtyhe
http://www.mediafire.com/?kn12jqzzmoy
New blog pages on Vaughan lines: http://genealogyconnections2.blogspot.com/
Eddie Davis author quoted here.

Post Note: If you carefully read in the Book of Morman AS HISTORY, of all the American Indian's, you'll discover that not all them where the dark types in the tribes. Some where white, especially the women who were captured by the Laminites from the Nephites i.e. Of course, this would effect the women's DNA.
http://en.wikipedia.org/wiki/Pre-Columbian_trans-oceanic_contact Others lived here before Columbus. Recommend reading; book 'America B.C." by Barry Fell if you are at all interested in learing about the evidence of pre-Colombus european (and other cultures as well) travelers/migrants to the Americas that very likely could have contributed to this odd DNA connection to Native Americans

Photo: Older tin-type, Vaughan Woman,

Thanks for your corrections and additions to these posts.

All comments are most welcomed! Site Meter

VAUGHAN LINE; Y-DNA RESULTS

Questions come up as to what the numbers on the meaning of the y-DNA. The DYS numbers are the position numbers assigned by the HUGO committee on the Y-DNA. The HUGO committee is an international group based in Cambridge, England who assign numbers to sections of the y-DNA being tested. This is therefore in world wide use.
The 12 marker test on y-DNA uses DYS 393, DYS 390, DYS 394 (before DYS numbers it was called 19), DYS 391, DYS 385a, DYS 385b, DYS 426, DYS 388, DYS 439, DYS 389-1, DYS 392 and DYS 389-2. So each DYS number is a position number for reference on the y-DNA.
Your results will be numbers for each DYS position. Example DYS 393 is 13, DYS 390 is 23, DYS 394 is 14, etc. The numbers 13, 23, 14 are STR numbers. STR stands for Short Tandem Repeat. What has been discovered is that DNA has gene sections which code for protein sequences and there are sections between genes which are called junk DNA. The junk sections seem to be of no use in coding for information about your body (protein sequences). It is the junk sections which are tested for genealogy.
The junk sections are made up of repeats of 2 to 5 DNA code letters. For example: if your DYS 393 is 13 it means the same DNA code sequence repeats itself 13 times. What Family Tree DNA is not telling you is the code of the sequence. They are merely telling you whatever the code is, it repeats itself 13 times. If the code was TAC (I am just selecting a possible sequence) the DYS 393 would be 13 repeats of TAC (TACTACTACTACTACTACTACTACTACTACTACTACTAC).
What is interesting is that when a mutation (a change) occurs in a junk region, a repeat tends to be added or deleted. So in the above example a mutation of DYS 393 would be the number 12 or 14. If you were a 12 you would have deleted a TAC. If you are a 14 you would have added a TAC. This type of addition or deletion mutation happen approximately ever 200 to 400 years. Useful for genealogical time.
The importance of testing y-DNA is to compare one man’s y-DNA to another. If you take the 37 marker test and match another man exactly you have a 50% probability of having a common male ancestor in the last 1.76 generations. If you match 36 of 37, you have a 50% probability of having a common male ancestor 4.27 generations back. If you match 35 of 37, you have a 50% probability of having a common male ancestor 6.82 generations back. If you match 34 of 37, you have a 50% probability of having a common male ancestor 9.37 generations back. In the 37 marker test you are looking for males who match you (the test male) either exactly or 1 or 2 markers off. You then contact them and compare genealogies to try to find the common male ancestor.
This helps explain the y-DNA test numbers. www.Eupedia.com/
This page for more about U2: http://en.wikipedia.org/wiki/Haplogroup_U_(mtDNA)
Photo: J Vaughan 1881
http://www.red4.co.uk/gallery/mid/tretower/tretower.htm Gallery of the Tretower
http://dorkschweitzer.net/geneticgenealogy

http://dirkschweitzer.net/ This site teaches the DNA to this line.
PHOTO; WILLIAM S - SOPHOMIA MYER FAMILY

*Recommend reading the book 'America B.C." by Barry Fell if you are at all interested in learning about the evidence of pre-Colombus Europeans (and other cultures as well) travelers/migrants to the Americas that very likely could have contributed to this odd DNA connection to Native Americans
Site Meter