Questions come up as to what the numbers on the meaning of the y-DNA. The DYS numbers are the position numbers assigned by the HUGO committee on the Y-DNA. The HUGO committee is an international group based in Cambridge, England who assign numbers to sections of the y-DNA being tested. This is therefore in world wide use.The 12 marker test on y-DNA uses DYS 393, DYS 390, DYS 394 (before DYS numbers it was called 19), DYS 391, DYS 385a, DYS 385b, DYS 426, DYS 388, DYS 439, DYS 389-1, DYS 392 and DYS 389-2. So each DYS number is a position number for reference on the y-DNA.
Your results will be numbers for each DYS position. Example DYS 393 is 13, DYS 390 is 23, DYS 394 is 14, etc. The numbers 13, 23, 14 are STR numbers. STR stands for Short Tandem Repeat. What has been discovered is that DNA has gene sections which code for protein sequences and there are sections between genes which are called junk DNA. The junk sections seem to be of no use in coding for information about your body (protein sequences). It is the junk sections which are tested for genealogy.
The junk sections are made up of repeats of 2 to 5 DNA code letters. For example: if your DYS 393 is 13 it means the same DNA code sequence repeats itself 13 times. What Family Tree DNA is not telling you is the code of the sequence. They are merely telling you whatever the code is, it repeats itself 13 times. If the code was TAC (I am just selecting a possible sequence) the DYS 393 would be 13 repeats of TAC (TACTACTACTACTACTACTACTACTACTACTACTACTAC).
What is interesting is that when a mutation (a change) occurs in a junk region, a repeat tends to be added or deleted. So in the above example a mutation of DYS 393 would be the number 12 or 14. If you were a 12 you would have deleted a TAC. If you are a 14 you would have added a TAC. This type of addition or deletion mutation happen approximately ever 200 to 400 years. Useful for genealogical time.
The importance of testing y-DNA is to compare one man’s y-DNA to another. If you take the 37 marker test and match another man exactly you have a 50% probability of having a common male ancestor in the last 1.76 generations. If you match 36 of 37, you have a 50% probability of having a common male ancestor 4.27 generations back. If you match 35 of 37, you have a 50% probability of having a common male ancestor 6.82 generations back. If you match 34 of 37, you have a 50% probability of having a common male ancestor 9.37 generations back. In the 37 marker test you are looking for males who match you (the test male) either exactly or 1 or 2 markers off. You then contact them and compare genealogies to try to find the common male ancestor.
This helps explain the y-DNA test numbers. www.Eupedia.com/
This page for more about U2: http://en.wikipedia.org/wiki/Haplogroup_U_(mtDNA)
Photo: J Vaughan 1881
http://www.red4.co.uk/gallery/mid/tretower/tretower.htm Gallery of the Tretower
http://dorkschweitzer.net/geneticgenealogy
http://dirkschweitzer.net/ This site teaches the DNA to this line.
PHOTO; WILLIAM S - SOPHOMIA MYER FAMILY
*Recommend reading the book 'America B.C." by Barry Fell if you are at all interested in learning about the evidence of pre-Colombus Europeans (and other cultures as well) travelers/migrants to the Americas that very likely could have contributed to this odd DNA connection to Native Americans
No comments:
Post a Comment