"GENEALOGY CONNECTIONS." It may aid your families connecting to my lines same surnames and their descendents. Comments most welcomed. These pages are "AS IS" corrections may need to be made. Photos are generally on the right pages. These pages are NOT FOR Re-SALE in any form or to be added to any "professional" genealogy programs or to their data, trees, software etc. All PUBLISHING right are reserved! Dedicated to all my COUSIN'S FOR THEIR JOY. May we meet in the resurrection!
Showing posts with label Vaughan's. Show all posts
Saturday, September 27, 2008
Wilson Vaughan
Wilson Vaughan b abt 1800 and Nancy Bowlin Vaughan b 1805 were the parents ofStokely, Wylie, Wesley, Mary and Clinton Vaughan.Based on this research, as shown below, its believed that Wilson VAUGHAN diedby April or before, in 1837.Levi Bowlin and Mary Asher Bowlin were the parents of Nancy Bowlin. Nancy isshown in Hawkins Co TN 1840 census, living close to Levi and brother James, with her children.*1829 Wilson Vaughan Dec 1829 bought land from Samuel Nicholson.Deed registered May 23, 1835.Dec 26, 1829 Land Title from Samuel Nicholson, county of Knox in TN to Wilson Vaughan, county of Hawkins TN, assigns a parcel of land on Duck Creek, including the improvement which the said Vaughan now lives.1830 Wilson Vaughan found in 1830 Hawkins Co TN census with wifeNancy Bowlin Vaughan, living adjacent to Levi Bowlin.1833 Sarah Nicholson to Levi Bowlen Reg'd March 4 1833. Samuelmay have been deceased in 1833. This property was adjacent to Wilson and Nancy's property.1835 Levi Bolin to John Bolin. Hawkins Co TN Deed Book 15, pg 179Reg'd 25 Jan 1835. Indenture made Oct 25, 1834. Witnessed by Wilson Vaughan.1836 Hawkins Co TN 1836 Taxpayers Dist 1, 2 (Dist 2 is whereWilson is. I have listed all the names in Dist. 2.Election to be held at James Murrell's.Isaac AMYX; Benjamin ATKISSON; Thomas BAKER; William BALDWIN Sr.;William BALDWIN JR.; Hannah BERRY; Levi BOLING; Gillum BUSH; JemimaBUTERY; Joab BREWER JR; Millinton BREWER; Ambrose BREWER JR; AmbroseBREWER SR; Hamel BREWER; Lydia BREWER; Joab BREWER JR (two JR'slisted but perhaps a transcription mistake since no SR is listed);Alexander CAMPBELL; Amburn CAFFEY; Cleveland CAFFEY; Jacob COPE; JohnCOPE JR; John COPE SR; Jesse COPE; James COPE SR; James COPE JR;Micajah COPE; Wm COPE; Wm COPE JR; Wm COPE SR; Larkin DAVIS; MadisonDAVIS; John DAY; Hiram DRINNON; Richard DRINNON; Wm DRINNON; HastiaDAVIS; Labourn FORD; Joseph GARLAND; Joseph GOODMAN; BenjaminGREEN; Eli GREEN; Joel GREEN; Richard GREEN; Wm GREEN; James HAMMERS;Micajah HAMMERES; Thomas HAMMERES; Thomas HARRIS; Abram HAWK; JohnHELTON; Elisha HOLLAND; John HOLLAND JR; John HOLLAND SR; LeonardHOLLAND; James JOHNSON; Wm JOHNSON; Elizabeth JONES; Peter JONES;Thomas JONES; Joseph LAMB SR; Joseph LAMB JR; James LAWSON; LucyMARTIN; Thomas MARTIN; Wm MARTIN; Thomas MATLOCKS; Robert McGEE;Solomon MILLIKEN; Henry MILLS; John MILLS SR; Reuben MATHIS; WmMcCULLOUGH; Henry MITCHELL; Richard MITCHELL SR; James MURRILL SR;Thomas MURRELL; Joshua ODAM; Temple PARRISH; Henry & LawrencePEARSON; Henry PEARSON; Reuben PORKYFISHE; Lazarus PHILLIPS; PatrickPHILIP; Thomas RAINS; Wm RAMSEY; Maney RHEA; Daniel REID; ArthurROBENS; Wm REECE; Joel ROBENS; Stephen ROBENS; Wm ROBENS; BaileySEALS; John SEALS; Samuel SEALS; Zachariah SEALS; John STATTEN;Charles SNIDER; Absalom TEMPLETON; James THOMPSON; Alexander TRENT;James TRENT SR; Benjamin TRENT; Richard TRENT; Wm TRENT SR;Wm TRENT JR; Zachariah TRENT; George TUCKER; Wm TUCKER; LeviTEMPLETON; Lewis TEMPLETON; John VAUGHAN; Wm VAUGHAN; Wilson VAUGHAN;John WELSH SR; David WILDER; George WILDER; Wm WILDER JR; Wm WILDERSR; Wm WILDER; Theadrick WEBB; Moses WILLIAMS; James WINSTEAD;Margaret WINSTEAD; Mathew WINSTEAD; Armistead WILLIS; Moses WILLIAMS.
Monday, 1 May 1837 ~~~~~~~~~~~~~~~~~~~~~~~~~State of TennesseeHawkins CountyBe it remembered that at a County Court begun and held at the courthouse in Rogersville in the county and state aforesaid on the 1st Monday of May, 1837, and of the Independence of the United States, the 60th, before: Nicholas Fain, James L. Etter, John A. Rogers, John Stokeley, Robert Brice, John Tunnell, Edward Lee, Robert Rogers, John Mitchell, Robert D. Young, John Shough, John Ball, Nicholas Beckner, Absolom Kyle; Justices of the Peace Commissioned and assigned to hold the County Court in said county and state.An inventory of the personal property of Wilson Vaughan, dec'd, sold by Nancy Vaughan, Administratrix, was returned to court by the said Administratrix which was received and ordered to be recorded.1840 Nancy Vaughan is found in 1840 census (Hawkins Co) living byLevi, with her children, with James on the other side of Levi. Wilsonis apparently deceased by then.1842 James Bowlin sells property and cites "the line of the heirs of Wilson Vaughan" to the line of Thomas Rains.Squire's Ledger for School Enrollment shows Nancy has enrolled her children inschool thru 1844. There are pages missing, but it appears that Nancy left Hawkins Coat that time for KY. Levi probably has died by then. Mary, Nancy's mother, left for KY withJames Bowlin so that may have been the reason Nancy left, but we are unable to find herlisted in an 1850 census.1849 Stokley left Fayette Co KY after having worked as a carpenter on Henry Clay's home.1850 Stokely married Amanda Sullivan, daughter of William Sullivan and Anna Rogers on July 26, 1850. The Sullivan's originated from Hawkins Co TN although Amanda was born in Indiana..1860 Nancy is found in 1860 census living in Carter Co KY with her sons Wesley and Clinton VAUGHAN. (Wesley, her son, goes to Civil War)1870 Nancy Bowlin Vaughan/n in 1870, age 65, found living in Jackson Co IN with son Wesley Vaughn and his family.1880 Nancy Bowlin Vaughan/n is living with her son, Wesley and his family in Lawrence Co IN. She is 75 years of age. She indicates on the census report that she was born in TN and her parents were born in KY.It is probable that Nancy died and is buried in Lawrence Co IN after 1880 and before 1882,however, we have yet to find any records of her death and where she probably is buried. Death records in Indiana were not kept before 1882This Indenture made and Entered into this 25 day of Oct. AD 183
Between Levi Bolin of the one part and John Bolin of the other part. Witnesseth the said Levi for and in consideration of the sum of Two hundred dollars to him in hand paid the receipt wherof is hereby acknowledged hath bargained sold delivered and do by these presents bargain sell alien convey in fee? of and confirm unto the said John a certain tract or parcel of land containing Fifty acres be the samemore or less lying in the county State afore said south of Clinch River Situated on the waters of Duck Creek & bounded as follows viz Beginning on said Creek at the mouth of a small branch on a buckeye & Sugar tree corner to John Holland, Wm Lied, thence northwardly with said Sealsline to the top of a ridge, thence westwardly to Vaughan's line thence with said Vaughn'sline Southwardly to Noel Seals line, thence with said Seals line Eastwardly to said Hollands line. Thence with said Hollands line to the Beginning together with all woods waters mines minerals hereditaments & appertenances thereunto belonging with the reversion or reversions rents appertenances(?) thereof unto the said John his heirs & assigns of the said Levi do warrant (unto the Said John his heirs & assigns –Note: this copy crossed out) & refund? the aforesaid tract or parcel of land from him his heirs Executors administrators & assigns unto the said John his heirs & assigns In witness whereof I have hereunto set my hand & Seal the day & date above written. Signed sealed and delivered in the presence of usWilson (+) Vaugn } Levi(+) Bolin {Seal}his mark }his mark John D Mathis State of Tennessee }Personally appeared before me Willis? B. Mitchellclerk of the Circuit Hawkins County }Court of Hawkins County the within named Levi Bolin with whom I am personally acquainted and who acknowledged thathe executed the within deed for the purpose therein mentioned witnessmy hand at office this 25 May AD 1835 – W.B. Mitchell Clk
*James Bowling to Moore & McCartyDeed Book 18, page 340Reg'd 27th August 1842State of Tennessee }Hawkins County } I James Bowling have this day bargained and sold and do hereby convey and transfer to Moore & McCart and their heirs forever for the consideration of three hundred Dollars to me paid A tract of Land lying in the county of Hawkins and State of Tennessee in Civil District number 2nd containing by Estimation fifty acres be the same more or less and bounded as follows vizBeginning on Duck Creek at the mouth of a branch On a buckeye and Sugar tree corner to John Holland's and Baily Seals Land thence northwardly with the said Seal line to the top of a ridge thence. Westwardly to the line of the heirs of William Vaughan Deceased thence with the said Heirs line Southwardly to Duck creek thence up the creek as it meanders to where the road crosses said Creek to a sycamore tree _____ the ford of said creek thence with Nancy Mathis line Southwardly along the fence to the corner of the field thence with the said Nancy Mathis line up the ridge to a marked Sourwood thence with the said line a direct corner? along said Ridge to a marked beechtree thence with the said Nancy Mathis line Westwardly across said ridge into the hollow to the line of the heirs of Wilson Vaughan Deceased thence Southwardly to Thomas Rains line thence with said Rains line Eastwardly to said Hollands line thence with said Hollands Northwardly to the Beginning. Together with all Woods Waters and Watercourses mines Minerals & etc. – To have and to hold the same to the said Moore & McCarty their heirs and assigns forever I do covenant with the said Moore & McCarty that I am lawfully seized of said Land have a good right to convey it and that the same is unencumbered I do further covenant and bind myself my heirs and representatives to warrant and forever defend the title to the said Land and every part and parcel thereof to the said Moore and McCarty their heirs and assigns against the lawful claim or claims of all persons whatever –Given under my hand and Seal this 26th day of August 1842.Signed sealed and delivered inpresence of usJames + Bowling {Seal}John + Bowlinghis markWilliam + Vaughanhis mark
*State of Tennessee }Hawkins County } Personally approved before me James W. Hord clk of the county court of said County, James Bowling the within named bargainor with whom I am personally acquainted and who acknowledged that he Executed the within deed of conveyance for the purposes therein contained.Witness my hand at office inRogersville this 27th day of Augt 1842Jas. W. Hord clk It is believed that Wilson was the son of John VAUGHAN and Judah HOLLAND, based on John's will.(Photo not connected with this page, Ayres Vaughan's Will i.e.)The ads are not an endorsement of this blog's author
Posted by PROTECT FROGS at 8:00 AM 1 comments
Labels: Ayres, Bowling, Stokley, Sullivan, Vaughan's
Sunday, September 21, 2008
Mary Francis Henderson, Vaughan
A page copied was copied about the settlers of Taney County. One was of Mary Francis Henderson, who married George Washington "Uncle Bud" Vaughan in Barry County, Missouri. She was said to have been born in the town of Roaring River, this no longer exists. Family stories say her mother (name never given) was 1/2 Cherokee and was on the Trail of Tears. As Barry County borders Taney one wonders if her mother might have been one of these Cherokee women. I think Mary's parents were Thomas Henderson and Nancy ____. Nancy would have been the 1/2 Cherokee woman. The 1850 census shows her being born in North Carolina. Thomas was shown as born in Tennessee. They lived in Searcy County, Arkansas in 1850, Tomahawk Township. In 1860 they lived in Stone County, Missouri, but suspecting, between these two censuses they lived in Barry County. (Photo tin-type, of Sarah Harp (Henley)
1850 Searcy County, Arkansas, Tomahawk Township Roll # 33481/83 Thomas Henderson, age 35, Male, Farmer, born in TennesseeNancy age 36, Female, born in North Carolina Can't read or writeJoseph N. age 10, Male, born in MissouriMary F. age 7, Female, born in ArkansasJames C. age 1, Male, born in MissouriIn 1860 they were in Stone County, Missouri1860 Stone County, Missouri, Williams Township, Roll # 606367/367 Thomas Henderson, age 46, Male, white, farmer, $1000/754, born in Tennessee Can't readNancy I. (?) Henderson, age 48, Female, white, born in North Carolina Can't read or writeJoseph N. Henderson, age 21, Male, white, Farm Laborer, born in MissouriJames C. Henderson, age 12, Male, white, born in ArkansasEliza Skidmore, age 24 or 27, Female, white, born in TennesseeWilliam T. Skidmore, age 11, Male, white, born in ArkansasJohn B. Skidmore, age 6, Male, white, born in ArkansasMargaret Price, age, 16, Female, white, born in Arkansas
...............................................................Another wrote:*About the book in TURNBOW'S TALES OF THE OARKS BIOGRAPHICAL STORIES STORIES. On page 23 he gives the names of a few of the early day people who lived on Crooked Creek, Marion Co., Ark. Bleuf Milum, Jimmy Magness, Noah ennette, Mose Rowlet, Joel King, Bill Wood, Eli Young, Jake Baughman, Luke Marler, Sam Harp, Nimrod Teaf, John Tabor, Herrod Coker, Demps Coker, Jimmie Shelton, Joel Sharp, and George Wood, Jimmy Mayberry. Mathew Harp is his mother was Judith(Judy) Brown and they are connected to the Blackwell Family of Taney Co.,& Hickory Co., Mo.Most of the early founders and settlers in Taney Co., were Cherokee woman married to white men and soldiers. They were from McMinn Co., Tenn. and traveled the "Trail of Tears". ---- Original Message -----Subject: Harp FamilyDo you have any approximate dates of birth for Sam & Matt Harp?Ans: I also have Matt Harp marring Judith Brown, Protem,Taney Co., Mo. no dates.----- Original Message -----Subject: "Within My Ozark Valley"A Sam Harp , Crooked Creek in Marion Co., Ark. This area is at the Ark. & Mo. border, White River. .................................................
*"Within My Ozark Valley". Has any one seen this bk.? William Vaughan, an adventurer from Wales (descendant of Thomas & Henry Vaughan) became a Indian trader. William Vaughan married a Cherokee maiden by the name of Fair-A- Bee-Lunah in the Cherokee Territory of Tennessee. Willian Vaughan and his son-in-law Philip Harp. They were in Eureka Springs, Ark. The great grandmother was Stone. Granny Molly Vaughan Stone, 1892. It speaks of the Civil War.The Vaughans & Harps have left a string of such houses to blaze the trail which they open all the way from Tennessee into the Ozarks. The towns spoken of were Cassville,, Mo.. Springfield, Mo. (Dr. Benjamin Franklin Pickley), Ft. Smith (then called Belle Point) Boston Mountains, Eureka Springs, Carrol, Madison and Newton Co., Ark. The more agricultural- minded Vaughans remained in Washington Co., Ark., where Samuel Vaughan, son of William, was one of the three commissioners who chose the site of Fayetteville, Ark. and helped survey it. He named the town for his home town, Fayetteville, Tenn. One can undestand the different spelling of Vaughan or Vaughn. Harps vs Erps, Earps. This book was written by CORA PINKLEY CALL, 1956. Many question some of the correctness of issues in the book. So do check everything out by other sources.
.................................Subject: Samuel and Daniel Vaughan
They lived around the Hawkins and Hancock Counties area -- there wasn't a Hancock County when they left Hawkins sometime after 1812, but just where they lived is still being debated. Most feel it was somewhere else in Tennessee, and very likely it was Warren and White Counties, Tennessee. There are grants in both counties for a Samuel and Daniel Vaughan and some indication that their sister Mary and her husband lived there:
Daniel: In Warren County, Tennessee in 1812, on a tax list, appears the name Daniel Vaughan, along with a David Vaughan. He apparently received land in White County, Tennessee, Grant # 5585 as an assignee of John C. McLemore, 3 acres lying in White County in the third District of Cane Creek of main Caney Fork including the house and improvements formerly occupied by John Medkiff, on May 23, 1814. In Deed Book F., page 73, he sold to John Simmons, both of White County, for $215, the land mentioned in the grant, on September 18, 1815. He appeared on the White County tax lists for 1815 and 1816.
Samuel: In Warren County, Tennessee, Grant # 5670, State of Tennessee to Samuel Vaughn, assignee of Peter Turney, 20 acres lying Warren County in the third District on the waters of Rocky River, June 4, 1814. Is this our Samuel?? Mary: Taken from her NOTES section: RECORDS ON VAUGHAN CONNECTION: On a Evans family reunion a few years back, and someone who attended gave a copy of the records that were circulated that day, and sent it to me, and it shows the following data:
MARY VAUGHAN, daughter of WILLIAM VAUGHAN, born 1779, Virginia. MARY VAUGHAN married JAMES EVANS - September 14, 1802, Hawkins County,Tennessee (Mary stated she was married in the home of her father, WILLIAM VAUGHAN) Their first son, JESSE EVANS, was born in 1803, Hawkins County,Tennessee, and Jesse's fifth child FERIBY EVANS was born in 1840. James Evans was listed near William Vaughan, Sr., John Vaughan, and William Vaughan, Jr. on the 1812 Tax Lists of Hawkins County,Tennessee. All appeared on the list taken by Wm. Nichols.
After his discharge from the War of 1812, James and Mary (Vaughan) Evans moved to White County, Tennessee, with her parents, where in 1816, James Evans witnessed an Indenture for WILLIAM VAUGHAN. James Evans died on 28 July 1820, in Fentress County, Tennessee, and hiswidow MARY EVANS continued on the Census of White and Van Burencounties, Tennessee. The Evans' were back and forth between what are now Van Buren (formerly White) and Fentress counties, TN. Mary died inAugust of 1873, Fentress County, Tennessee.The ads are not an endorsement of this blog's author
Posted by PROTECT FROGS at 10:55 AM 0 comments
Labels: Books, Evans, Henderson, Skidmore, Vaughan's
Saturday, September 20, 2008
Desentants Of John Vaughan
Descendants of John Vaughan Generation No. 11. JOHN1 VAUGHAN died 1820 married JUDITH HOLLAND. She was born Abt. 1761.Notes for JOHN VAUGHAN:His will is found in Hawkins County, Tennessee dated April 10, 1820. One of his descendants through his son Wilson matches our Vaughans' Y-DNA perfectly.WILL OF JOHN VAUGHANPage 471 Dated: Apr. 10, 1820In the Name of God, Amen. I John Vaughan, being very weak in body but of sound mind and memory, calling to mind that it is appointed for all men to die doth make this my last Will & Testament. In the first place, I give and bequeath unto my beloved wife Judy Vaughan all my house furniture and with my horses, cattle and hogs as long as she lives, and then for her to divide all that property equally between Polly, Wilson, Benjamin and Isham, a son of my daughter Clary’s to have his part equal to the other three, and there is William and Agathe and Jonathan—shall have five shillings each. Whereof I have hereunto subscribed my hand and caused my seal to be affixed. This 10th day of April, 1820.John x Vaughan (seal)(his mark)Witness Present:Thomas Hammon (Jurat)Howel BrewerChildren of VAUGHAN and JUDITH HOLLAND are:i. WILSON2 VAUGHAN, b. 1800, Tennessee; d. Bef. April 01, 1837, Hawkins County, Tennessee; m. NANCY BOWLEN/BOWLING, 1829, Tennessee; b. 1805, Tennessee; d. Bef. 1900, Lawrence County, Indiana.Notes for WILSON VAUGHAN:Wilson Vaughan and Nancy Bowlin Vaughan were the parents ofStokely, Wylie, Wesley, Mary and Clinton Vaughan.Based on research, as shown below, we believe Wilson VAUGHAN diedby April or before, in 1837.It is believed Levi Bowlin and Mary Asher Bowlin were the parents of Nancy Bowlin. Nancy isshown in Hawkins Co TN 1840 census, living close to Levi and brother James, with her children.1829 Wilson Vaughan Dec 1829 bought land from Samuel Nicholson.Deed registered May 23, 1835.Dec 26, 1829 Land Title from Samuel Nicholson, county of Knox in TN to Wilson Vaughan, county of Hawkins TN, assigns a parcel of land on Duck Creek, including the improvement which the said Vaughan now lives.1830 Wilson Vaughan found in 1830 Hawkins Co TN census with wifeNancy Bowlin Vaughan, living adjacent to Levi Bowlin.1833 Sarah Nicholson to Levi Bowlen Reg'd March 4 1833. Samuelmay have been deceased in 1833. This property was adjacent to Wilson and Nancy's property.1835 Levi Bolin to John Bolin. Hawkins Co TN Deed Book 15, pg 179Reg'd 25 Jan 1835. Indenture made Oct 25, 1834. Witnessed by Wilson Vaughan.1836 Hawkins Co TN 1836 Taxpayers Dist 1, 2 (Dist 2 is whereWilson is. I have listed all the names in Dist. 2.Election to be held at James Murrell's.Isaac AMYX; Benjamin ATKISSON; Thomas BAKER; William BALDWIN Sr.;William BALDWIN JR.; Hannah BERRY; Levi BOLING; Gillum BUSH; JemimaBUTERY; Joab BREWER JR; Millinton BREWER; Ambrose BREWER JR; AmbroseBREWER SR; Hamel BREWER; Lydia BREWER; Joab BREWER JR (two JR'slisted but perhaps a transcription mistake since no SR is listed);Alexander CAMPBELL; Amburn CAFFEY; Cleveland CAFFEY; Jacob COPE; JohnCOPE JR; John COPE SR; Jesse COPE; James COPE SR; James COPE JR;Micajah COPE; Wm COPE; Wm COPE JR; Wm COPE SR; Larkin DAVIS; MadisonDAVIS; John DAY; Hiram DRINNON; Richard DRINNON; Wm DRINNON; HastiaDAVIS; Labourn FORD; Joseph GARLAND; Joseph GOODMAN; BenjaminGREEN; Eli GREEN; Joel GREEN; Richard GREEN; Wm GREEN; James HAMMERS;Micajah HAMMERES; Thomas HAMMERES; Thomas HARRIS; Abram HAWK; JohnHELTON; Elisha HOLLAND; John HOLLAND JR; John HOLLAND SR; LeonardHOLLAND; James JOHNSON; Wm JOHNSON; Elizabeth JONES; Peter JONES;Thomas JONES; Joseph LAMB SR; Joseph LAMB JR; James LAWSON; LucyMARTIN; Thomas MARTIN; Wm MARTIN; Thomas MATLOCKS; Robert McGEE;Solomon MILLIKEN; Henry MILLS; John MILLS SR; Reuben MATHIS; WmMcCULLOUGH; Henry MITCHELL; Richard MITCHELL SR; James MURRILL SR;Thomas MURRELL; Joshua ODAM; Temple PARRISH; Henry & LawrencePEARSON; Henry PEARSON; Reuben PORKYFISHE; Lazarus PHILLIPS; PatrickPHILIP; Thomas RAINS; Wm RAMSEY; Maney RHEA; Daniel REID; ArthurROBENS; Wm REECE; Joel ROBENS; Stephen ROBENS; Wm ROBENS; BaileySEALS; John SEALS; Samuel SEALS; Zachariah SEALS; John STATTEN;Charles SNIDER; Absalom TEMPLETON; James THOMPSON; Alexander TRENT;James TRENT SR; Benjamin TRENT; Richard TRENT; Wm TRENT SR;Wm TRENT JR; Zachariah TRENT; George TUCKER; Wm TUCKER; LeviTEMPLETON; Lewis TEMPLETON; John VAUGHAN; Wm VAUGHAN; Wilson VAUGHAN;John WELSH SR; David WILDER; George WILDER; Wm WILDER JR; Wm WILDERSR; Wm WILDER; Theadrick WEBB; Moses WILLIAMS; James WINSTEAD;Margaret WINSTEAD; Mathew WINSTEAD; Armistead WILLIS; Moses WILLIAMS.Monday, 1 May 1837State of TennesseeHawkins CountyBe it remembered that at a County Court begun and held at the courthouse in Rogersville in the county and state aforesaid on the 1st Monday of May, 1837, and of the Independence of the United States, the 60th, before: Nicholas Fain, James L. Etter, John A. Rogers, John Stokeley, Robert Brice, John Tunnell, Edward Lee, Robert Rogers, John Mitchell, Robert D. Young, John Shough, John Ball, Nicholas Beckner, Absolom Kyle; Justices of the Peace Commissioned and assigned to hold the County Court in said county and state.An inventory of the personal property of Wilson Vaughan, dec'd, sold by Nancy Vaughan, Administratrix, was returned to court by the said Administratrix which was received and ordered to be recorded.Don't know if he is related to the VaughnsLDS Film #1301904 Bartholomew County, Indiana DeedsElias Vaughn and Martha, his wife, sold to Edward Springer forland in Elizabethtown for $118 dated 12-1-1868.Transcription:Sam'l Nicholson To Wilson VaughanHawkins Co., TN. Deed Book 15, pgs 179-180Red'd 23'd May 1835This indenture made the 26th day of December 1829 Between Samuel Nicholson of the County of Knox & State of Tennessee of the one part & Wilson Vaughan of the county of Hawkins & State of Tennessee of the other part witnesseth that the said Samuel Nicholson for & in consideration of the sum of fifty dollars to him in hand paid the receipt whereof is hereby acknowledged hath bargained & sold and by these presents doth convey & confirm unto the Said Wilson Vaughn his heirs or assigns forever a certain tract or parcel of land of land situated in the county of Hawkins on the north side of Clinch Mountain on Duck Creek including the improvement which the said Vaughan now lives. Beginning on the South side of said creek on a mulberry in a hollow running thence northwardly with Levi Bolin line to the top of the ____ ridge to a black walnut then along the top of said ridge a straight line to the line of the heirs of Joseph Rhea dec'd then with said line southwardly then eastwardly to the Beginning or as to include fifty acres more or less Together with the hereditaments appurtenances thereunto belonging the said Samuel Nicholson for him his heirs & to the said Wilson Vaughan & his heirs & assigns will warrant & forever defend against the lawful claim of Every other person by these presents as an ___ ______ inheritance in fee simple – In testimony whereof the said Samuel Nicholson by my attorney hath herewith set my hand & seal the day & year above written.Samuel Nicholson {Seal}Signed sealed & delivered in presence of by his atty in fact G. McCraw____Mitchell, Howell BrownState of Tennessee } Court of Pleas February Session 1830Hawkins County } A deed of conveyance from Samuel Nicholson by Gabriel McCraw his attorney in fact to Wilson Vaughan for fifty acres of land was acknowledged in open Court and ordered to be registered. ___ Mitchell ClkBy M.B. Mitchell DClkTranscribed from copy of original record from the Hawkins Co., TN courthouseDiane Hubbard JonesNotes for NANCY BOWLEN/BOWLING:1840 Nancy Vaughan is found in 1840 census (Hawkins Co) living byLevi, with her children, with James on the other side of Levi. Wilsonis apparently deceased by then.1842 James Bowlin sells property and cites "the line of the heirs of Wilson Vaughan" to the line of Thomas Rains.Squire's Ledger for School Enrollment shows Nancy has enrolled her children inschool thru 1844. There are pages missing, but it appears that Nancy left Hawkins Coat that time for KY. Levi probably has died by then. Mary, Nancy's mother, left for KY withJames Bowlin so that may have been the reason Nancy left, but we are unable to find herlisted in an 1850 census.1849 Stokley left Fayette Co KY after having worked as a carpenter on Henry Clay's home.1850 Stokely married Amanda Sullivan, daughter of William Sullivan and Anna Rogers on July 26, 1850. The Sullivan's originated from Hawkins Co TN although Amanda was born in Indiana..1860 Nancy is found in 1860 census living in Carter Co KY withher sons Wesley and Clinton VAUGHAN.(Wesley, her son, goes to Civil War)1870 Nancy Bowlin Vaughan/n in 1870, age 65, found living inJackson Co IN with son Wesley Vaughn and his family1880 Nancy Bowlin Vaughan/n is living with her son, Wesley and hisfamily in Lawrence Co IN. She is 75 years of age. She indicates onthe census report that she was born in TN and her parents were bornin KY.It is probable that Nancy died and is buried in Lawrence Co IN after 1880 and before 1882,however, we have yet to find any records of her death and where she probably is buried. Death records in Indiana were not kept before 1882.State of TennesseeHawkins CountyBe it remembered that at a County Court begun and held at the courthouse in Rogersville in the county and state aforesaid on the 1st Monday of April in the year of our Lord, 1837, and of the Independence of the United States, the 60th, before: Nicholas Fain, John A. Rogers, John Mitchell, Robert W. Kinkead, Robert D. Young, John Stokeley, John Tunnell, John Reynolds, Absolom Kyle and Robert Brice; Justices of the Peace Commissioned and assigned to hold the County Court in said county and state.On motion, leave is given Nancy Vaughan to administer on the estate of Wilson Vaughan, dec'd, and thereupon the said Nancy Vaughan came into court and having entered into bond with approved security was qualified in due form of law.An inventory of the personal property of Wilson Vaughan, dec'd, was returned to court by Nancy Vaughan, the Administrix, which was ordered to be received and recorded.----------Monday, 1 May 1837State of TennesseeHawkins CountyBe it remembered that at a County Court begun and held at the courthouse in Rogersville in the county and state aforesaid on the 1st Monday of May, 1837, and of the Independence of the United States, the 60th, before: Nicholas Fain, James L. Etter, John A. Rogers, John Stokeley, Robert Brice, John Tunnell, Edward Lee, Robert Rogers, John Mitchell, Robert D. Young, John Shough, John Ball, Nicholas Beckner, Absolom Kyle; Justices of the Peace Commissioned and assigned to hold the County Court in said county and state.An inventory of the personal property of Wilson Vaughan, dec'd, sold by Nancy Vaughan, Administratrix, was returned to court by the said Administratrix which was received and ordered to be recorded.ii. POLLY VAUGHAN.iii. JONATHAN VAUGHN, b. 1800, Tennessee; d. 1850; m. SPICY; b. 1796, North Carolina; d. 1850.Notes for JONATHAN VAUGHN:Found in Hawkins County in 1830, Grainger County in 1840 and Claiborne County in 1850, all in Tennessee.Claiborne County, Tennessee 1850 Census Subdivision 7179/179 Jonathan Vaughn 50 TNSpicy 56 NCDicy 36 TNBenj. 19 TNElizabeth 7 KYThomas King 20 TNiv. AGATHE VAUGHAN.v. WILLIAM VAUGHAN, d. 1835.vi. BENJAMIN VAUGHAN.vii. ISHAM VAUGHAN.viii. CLARY VAUGHAN.Notes for CLARY VAUGHAN:Was dead by the time her father made his will, but her son, Isham VAUGHAN was named. Did she die in childbirth?The ads are not an endorsement of this blog's author
Posted by PROTECT FROGS at 10:37 AM 0 comments
Labels: Bowling, Holland, Vaughan's
Monday, September 1, 2008
Pg-2 Name List (Genealogy)
See other pages that connect to this page. Feel free to correct in comments..... Thanks
3957 ALBRIGHT, Heidi Elizabeth 21 Jan 1967 1685 S Mark PETERSON3956 ALBRIGHT, Ted 15 Jul 1946 1684 S Sharon Elizabeth STOKER2504 ALDEN, Darius 26 Jan 1778 WFT Est 1795-186 1123 S Marilda ELLSWORTH2534 ALDEN, Elijah , Jr. 4 Apr 1776 WFT Est 1806-186 1135 S Polly FORISTALL2520 ALDEN, Elisha , Jr. 1767 1846 1130 S Clarissa BARKER2498 ALDEN, Elisha Lieutenant 15 Nov 1745 3 Mar 1826 1118 S Irene MARKHAM2516 ALDEN, Fear 7 Apr 1774 7 Jul 1807 1128 S David GLAZIER2503 ALDEN, Irene 24 Feb 1772 13 Nov 1858 1122 S Joseph MERRICK2512 ALDEN, Israel 18 May 1747 1817 1127 S Lucy MARKHAM2537 ALDEN, Jemima 10 Nov 1777 WFT Est 1820-187 1137 S Joseph ADAMS2538 ALDEN, Joanna 30 Nov 1783 WFT Est 1784-187 1133 P Noah ALDEN , Jr.2525 ALDEN, Joanna Abt 1750 WFT Est 1788-184 1132 S Aaron LELAND Reverend2522 ALDEN, Joanna WFT Est 1761-1791 WFT Est 1767-187 1118 P Elisha ALDEN Lieutenant2518 ALDEN, Joseph Abt 1789 WFT Est 1839-188 1129 S Lucy ? ALDEN2511 ALDEN, Joseph 1753 1832 1126 S Lydia HYDE2526 ALDEN, Lucy 2 Jul 1749 WFT Est 1750-184 1120 P Noah ALDEN Reverend2519 ALDEN, Lucy ? Abt 1796 WFT Est 1839-189 1129 S Joseph ALDEN2555 ALDEN, Lydia 1 Apr 1751 WFT Est 1752-184 1120 P Noah ALDEN Reverend2539 ALDEN, Lydia 7 Jan 1782 WFT Est 1783-187 1133 P Noah ALDEN , Jr.2505 ALDEN, Nathan 5 Sep 1768 9 Nov 1840 1124 S Sarah BESTON2500 ALDEN, Noah 1 Sep 1784 WFT Est 1785-187 1118 P Elisha ALDEN Lieutenant2528 ALDEN, Noah , Jr. Abt 1750 WFT Est 1788-184 1133 S Joanna COOK2540 ALDEN, Noah III 7 Jan 1785 WFT Est 1786-187 1133 P Noah ALDEN , Jr.2509 ALDEN, Noah Reverend 31 May 1725 5 May 1797 1120 S Joanna VAUGHAN2527 ALDEN, Ruth Abt 1750 WFT Est 1751-184 1120 P Noah ALDEN Reverend2573 ALDEN, Samuel 1751 3 Jan 1755 1120 P Noah ALDEN Reverend2496 ALDEN, Samuel Deacon 21 Feb 1776 1856 1116 S Keziah BLODGETT2501 ALDEN, Serena WFT Est 1761-1791 WFT Est 1767-187 1118 P Elisha ALDEN Lieutenant2521 ALDEN, Simeon 27 Jun 1770 WFT Est 1771-186 1118 P Elisha ALDEN Lieutenant2502 ALDEN, Spencer 1772 1858 1121 S Mary ROCK2532 ALDEN, Timothy 1770 1859 1134 S Lois WILCOX2541 ALDEN, Zilpha 4 Jan 1780 WFT Est 1809-187 1138 S Benjamin HAYWARD7592 ALDINGER, Christina Joy 17 Aug 1985 2945 P Gary ALDINGER7588 ALDINGER, Gary 31 Oct 1952 2945 S Diane Gayle HADLEY7591 ALDINGER, Nicholas 16 Jun 1979 2945 P Gary ALDINGER8598 ALDRICH, Martha Jean Abt 1922 3333 S Loren Jesse HAGGARD11038 ALLARD, Susan Elizabeth 4069 S Phillip Martin FRICK5084 ALLEN, 2100 S Lydia Myrtle CALICO3879 ALLEN, Betty Jane 6 Nov 1877 19 Jan 1930 1654 S William Clint CREECH3599 ALLEN, Howard 1558 S Mary VAUGHAN7551 ALLEN, Iva Lee 1 Oct 1944 2927 S Donald Eugene GRIMES1922 ALLEN, Jack Elton 6 Jul 1923 2 Jul 1979 857 S Leta Mae CROWLEY7563 ALLEN, Jacob Caleb 16 Dec 1986 2929 P James Dwight ALLEN7539 ALLEN, James Clarence "Jim" 8 Dec 1913 2915 S Hazel Lucille HADLEY7553 ALLEN, James Dwight 11 Sep 1950 2929 S Patricia Lou "Pat" HALLUM6818 ALLEN, Jolena Renee Private 2669 P Lonnie Edward ALLEN7562 ALLEN, Joshua Chad 3 Mar 1982 2929 P James Dwight ALLEN6819 ALLEN, Kristina Private 2669 P Lonnie Edward ALLEN6815 ALLEN, Lonnie Edward Private 2669 S Doris Ruth GLASPIE7554 ALLEN, Mary Elaine 26 Apr 1952 2930 S Ronald E GARDNER 1st H3857 ALLEN, Mary Saloan 1643 S Stephen Nelson CREECH6816 ALLEN, Myra Antoinette Private 2669 P Lonnie Edward ALLEN6350 ALLEN, Robert 749 P Robert Wendell FERRELL5729 ALLEN, Roy 2372 S Anna Ruth STANFORD8896 ALLEN, Samantha Gayle 14 Jul 1995 2929 P James Dwight ALLEN
Posted by PROTECT FROGS at 9:40 AM 0 comments
Labels: Alden, Aldinger, Aldrich, Allen, Genealogy List, Vaughan's
Pg-1 Genealogy List
This is page one of some of our family names....Please add data or corrections in comment for all of us genealogists in the family. (Cousin's)
762 A., Florah 456 S James VAUGHAN4562 ABBOTT, Irene 16 Jan 1885 1 Mar 1948 1898 S Thomas H HENDERSON11317 ABBS, Elizabeth 3477 S John Calvin CALICO2021 ABELL, Ronald Conally 26 Oct 1945 899 S Margaret Ann CROWLEY2022 ABELL, Shani Daniele 8 Dec 1968 899 P Ronald Conally ABELL11103 ABERCOMBIE, Odessa Walden 486 S Joseph L. VAUGHAN10898 ACUFF, Danny 4050 P James ACUFF10899 ACUFF, Denetta 4050 P James ACUFF10897 ACUFF, Doug 4050 P James ACUFF10896 ACUFF, James 4050 S Stella LYNCH10900 ACUFF, Kim 4050 P James ACUFF7204 ADAMS, Charles Phillip 8 Aug 1919 21 Apr 1977 2790 S Cecil Louise SATATHITE6685 ADAMS, Dana 7 Jun 1966 2628 S Joe Patrick GREEN11284 ADAMS, Estel May 3954 P James Washington ADAMS667 ADAMS, George Arlan 403 S Betty Joann VAUGHN6434 ADAMS, Harvey M. 1888 2520 S Essie MYERS9994 ADAMS, Ica 3781 S Kathleen VAUGHAN9995 ADAMS, Ica Jr. 3781 P Ica ADAMS11285 ADAMS, James Holland 3954 P James Washington ADAMS10549 ADAMS, James Washington 22 Dec 1887 15 Jun 1962 3954 S Artie Augusta May CALICO7205 ADAMS, Janet Louise 27 Mar 1945 2790 P Charles Phillip ADAMS2543 ADAMS, Joseph WFT Est 1762-1796 WFT Est 1820-188 1137 S Jemima ALDEN11283 ADAMS, Nina 3954 P James Washington ADAMS10626 ADAMS, Oakie Wilson 3954 P James Washington ADAMS7206 ADAMS, Sharon 29 Aug 1947 2790 P Charles Phillip ADAMS9996 ADAMS, Stacy 3781 P Ica ADAMS5582 ADAMS, Tom B. 2294 S Mary BEACH7095 ADDINGTON, Jack 2768 P Jess ADDINGTON7094 ADDINGTON, Jess 2768 S Mid SATATHITE4246 ADIER, Mahala 1844 1900 1788 S Samuel R LINDLEY3257 ADKINS, \\ WFT Est 1790-1826 WFT Est 1798-190 1412 S Jinsey VAUGHAN555 ADKINS, Washington 99 S Lucinda VAUGHAN3738 AGNES, BET 1769 AND 17 1600 S George VAUGHAN3783 AGNESS, 1469 S George VAUGHAN11454 AGNEW, Bonnie Kay 2 Aug 1949 4147 S Stanley Lane SISMORE4561 AIKEN, Mary Abt 1846 1929 S John H HENDERSON4733 AIKEN, Molly Marie Polly Mollie 11 Mar 1854 10 Feb 1938 1980 S Charles J C HENDERSON5150 AILSEY, 2138 S John BROWN2359 AINSWORTH, 1072 S Delores "Dody" SIMMONS7058 AINSWORTH, Emily Mae Christine 2757 S James Garfield SATATHITE2354 AIRD, Georgia 1071 S Merle SIMMONS7117 AKE, Allen Kent 2751 P Robert Jackson AKE7122 AKE, Allen Roscoe 2753 P Cole Roscoe AKE7121 AKE, Annette Harriet 2753 P Cole Roscoe AKE7047 AKE, Cole Roscoe 6 Sep 1911 Jul 1984 2753 S Beatrice C. WILLIAMS7118 AKE, Karen Jane 2751 P Robert Jackson AKE7046 AKE, Marvin Parvis 11 Mar 1913 10 Mar 1994 2752 S Bessie BANNERMAN7045 AKE, Robert Jackson 5 Feb 1916 1 Jan 1954 2751 S Virginia UNDERWOOD7119 AKE, Robert Neal 2751 P Robert Jackson AKE6555 AKE, Robert Volney 13 May 1880 6 Aug 1935 2576 S Winnie Mariah SATATHITE7044 AKE, Winnie Margaret 4 Mar 1917 2750 S DEWALK9885 AKERS, Julia Lynn 3746 S Russell Dale REAGAN694 ALBERDING, Billy Dale 23 Mar 1957 427 S Roberta ILene BAKER704 ALBERDING, Billy Dale , jr 30 Jan 1980 427 P Billy Dale ALBERDING695 ALBERDING, Brandy Rachelle 24 Mar 1986 427 P Billy Dale ALBERDING3962 ALBRIGHT, Heather Lynn 11 Jun 1969 1686 S Chris BURNSAdvertisements are not an endorsement by this blog's
Posted by PROTECT FROGS at 9:34 AM 0 comments
Labels: Genealogy List, Vaughan's
Thursday, August 7, 2008
E-mail No. 1 Vaughan, Callicot, Roller
Email of Vaughan Line No. 1 (All is quoted)"http://members.tripod.com/~Hiestand/roller/JOHANNES.HTM that shows John's ancestry. It lists Rebecca as Rebecca Falin Vaughan and gives her birth date as June 24th, 1801, which compares to what Nancy (Callicott) Vaughan gave for her daughter "Rebechah G. was born June the 24 day 1802" As I mentioned last week, in her father's day book, her name is shown as: Rebechah Gruer was born June the 24 day 1802 with the "2" in 1802 written over an originally recorded "1". So it is very likely that Rebeccah did not know exactly when she was born.The problem of course is that a Rebechah or Rebecca Gruer Vaughan sounds pretty different then a Rebecca Falin Vaughan. I am 100% certain the two women are the same person, but how did the name Falin come into the story. And why was Rebecca's middle name Gruer. What follows is a transcript of Benjamin Vaughan's affidavit for his mother Nancy (Callicott) Vaughan's Revolutionary War pension application. Ben was one of the middle born children of John and Nancy, and he gives in 1858 a bit of information on where his sister Rebecca lived:State of Tennessee county of Hancock.Be it remembered that on this 28 day of May AD 1858 formally appeared before me a Justice of the Peace in and for the county aforementioned Benjamin Vaughn aged about 54 years, after being by me duly-sworn according to you both on his oath depose and say that he will be fifty four years of age on the 4th day of November in 1858 to the best of his knowledge information and belief. He further certifies that the enclosed record of my father. John & Nancy Vaughn is the record which was found knowing my fathers old paper and it has ever since remained to my possession and as to the correctness of which I certify that I can recollect the birth of Samuel, Martha & George W. Vaughn which part of the record I certify from my resolution and from circumstances is correct and that I certify that James, Polly. Beverly. Rebeky Vaughn are all four elder than me and that the last account I had of James he was in the State of Texas and that the last account I had of Beverly he was in the State of Arkansas and that Polly lives in Hawkins County in the State of Tennessee. Rebecky lives in the State of MO the last account, and that Nancy, Mahaly & John are all three younger than me but I cannot recollect the dates of their births and that Nancy & John lives in this county and that Mahaly is dead and that Samuel resides in the county and that the last account of George is he lived near Nashville Tennessee and that Martha lives in Knox County in the Stale of Tennessee and that my father John Vaughan died on the 14 day of July 1842 and that at his death he left a will in which I certify he willed to me John & Samuel Vaughn the tract of land where and now live and where on Samuel now lives that they paid him after the death of their said father $100. for his part of said tract of land and that his other lands and Tenements was divided amongst the other heirs and that I further certify that I know of know other record of the dates and births of said heirs or any other dates I recorded after the marriage if any such record either private or public he does not know any thing of them, and I further certify that after the Act of 1832 I heard my father frequently speak of his claim that he said that he would not trouble himself about it that he did not need it and that inSeveral occasions I have heard him in conversation with one Samuel Doloson who is no more and who runs a van, drinking character and who applied for pensionDoloson, could obtain his pension and could get what was due to him JohnVaughn that he, Doloson. would have money enough to pay for his drinking and thatDoloson never received a pension ?In witness I do here unto set my hand and seal the day and year.Benjamin*1858 Rebecca was living in Missouri, and this, plus her father's will, shown below, pretty much settles that the Rebecca Roller in Barry County, MO., was the same as John and Nancy's daughter:WILL OF JOHN VAUGHANPage 474 Dated: Dec. 27, 1841Proven: Aug. Term 1842I, John Vaughan of the County of Hawkins and State of Tennessee, do make this my last Will & Testament hereby revoking and making void all former wills by me heretofore made.First. My will and desire is that all my just debts be paid out of any money that I may die possessed of, or that may first come into the hands of my Executors. Second. My will and desire is that my son George Washington, for and in consideration of the bequests hereinafter made to him do keep and support my wife Nancy Vaughan during her natural life.Third. I do give and bequeath unto my sons Samuel N. Vaughan and Benjamin Vaughan during their natural lives and then to their lawful heirs forever all my lands on the north side of Clinch Mountain, it being about 110 acres and 10 acres on the south side to copper ridge whereon the said Samuel N. Vaughan now lives, to be equally divided between them according to quality.Fourth. I do will and direct that the above named Samuel N. and Benjamin Vaughan for and in consideration of the above bequest shall within 12 months after my death jointly pay unto my son John Vaughan $100.00.Fifth. I give and bequeath unto my son George Washington Vaughan all my land whereon I now live and joining it being about 170 acres, together with all my personal estate that I may die possessed of or entitled to, and all money and debts due me except so much as may be necessary to supply the bequests made in this will in money.Sixth. Whereas my sons Beverly Vaughan and James L. Vaughan has gone to parts unknown, if they should return within two years after my death, I do give and bequeath to them one dollar each.Seventh. I do give and bequeath unto the heirs of my daughter Mahala Dickerd one dollar. Eighth. I do give and bequeath unto my daughter Mary Gilliam one dollar.Ninth. I do give and bequeath unto my daughter Rebecca Roller $1.00.Tenth. I do give and bequeath unto my daughter Nancy Hickman $1.00.Eleventh. I do give and bequeath unto my daughter Martha Davis $1.00.And for the performance and execution of this my last will, I do appoint Robert W. Kinkead my Executor. In testimony whereof I have here unto set my hand and seal. This 27th day of December, 1841.John x Vaughan (seal)(his mark)In presence of: William Carmack, James T. Brice, William E. Carmack."" 1841, Rebecca had married John Roller and by 1858 they lived in Missouri. So again, the question presents itself - where does the name FALIN come from? And, what about her middle name, GRUER? I'm really beginning to wonder if maybe John and Nancy had adopted several children either from different families, or else took in the children of one family. It could be that James (who married Martha Vaughan, William and Fereby's daughter) and Rebecca and maybe several others of their children were not biologically theirs. That would explain why my Ben Vaughan (named, no doubt for the Benjamin Vaughan who made the affidavit for Nancy, the elder Ben would have been my Ben's uncle) had Y-DNA that didn't match John and William's Y-DNA. Maybe it was his father, James, who, along with Rebecca, were adopted. Rebecca is the only child in John's day book with a second name attached, and James, the oldest child, does not have any last name listed in the book. Beverly was listed as "Beverly Callicott" (his mother's father's name), but the name was crossed out and "Beverly Vaughan" was entered in it's place. So it could be that Beverly, James and Rebecca were all not John's children.At the website I mentioned above, it shows how many of the Rollers went to the area around what is now McDonald County, Missouri and Benton County, Arkansas. The two counties border each other and a ridge around Gateway, Missouri is named "Roller Ridge" after them. McDonald county borders Barry County, where John and Rebecca Roller moved, and of course, Benton County borders Madison County, AR., so they were only a short distance from the family of William and Fereby.The question is, where were John and Rebecca in 1850? We know they were married by 1841, so they should show up somewhere. There is a John Roller on the 1850 Barry County, MO. census, but it is the father of the John that married Rebecca, according to the Roller web site. His wife was Mary Tutwiler and both of them were in Barry County, MO., living with an Adam Roller, probably a grandson. According to the site, John was there since 1830. I wonder if John and Rebecca were in Barry County early, or if they moved there later? They were not there in 1850, apparently. There are really no solid leads on them in 1850. Anyway, keep searching for some clues on John and Rebecca, as I feel if we locate some of John and Nancy's children in the 19th century, we might clear up some other mysteries of this family."
~~~~~~~~~~~~~~~~~~~~~
Email: Hello Cousins...I think I may have stumbled across something interesting and I need the groups help. I was browsing around FindaGrave.com and I saw this entry.http://www.findagrave.com/cgi-bin/fg.cgi?page=gr&GRid=7947280We have always had in our tree that a REBECCA (REBECKAH) VAUGHN had married a JOHN ROLLER. I decided to focus today on this JOHN ROLLER and all I knew was Barry Co Missouri. In looking at this entry for him the dates are in the same range. I also got excited to see a REBECCA buried next to him there in the King Cemetery. The VAUGHN bible/day book that JOHN Vaughn b1762 VA...completed for his REVOLUTION PENSION lists all his Children and their birth dates.He lists a child named REBECKAH b. JUNE 24 1800 1801? (this entry is near the bottom right corner...hard to read but its there)The person that loaded the grave info's family site is here....http://www.lgboyd.com/I see that his charts list her maiden name as FALIN and she married JOHN in Tennesee in 1801.Their Children are:ChildrenJasper ROLLER b: ABT 1820 in VirginiaAndrew Jackson ROLLER b: 12 MAY 1822 in VirginiaGeorge Washington ROLLER b: ABT 1824 in VirginiaAmos ROLLER b: ABT 1826 in VirginiaElizabeth ROLLER b: ABT 1828 in VirginiaMary "Polly" ROLLER b: 19 JAN 1835 in VirginiaLucinda ROLLER b: 15 NOV 1836 in VirginiaJohn ROLLER b: ABT 1839 in TennesseePatrick E. "Pad" ROLLER b: MAR 1841 in TennesseePhillip ROLLER b: ABT 1844 in Virginia Ironically our Rebeckah Vaughn also had a sister named MARY POLLY and a Brother named George Washington.......Her dates on this tombstone match and other things.?"~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~E-mail about "Missouri Pioneers", Vol. 1, 1967 Early settlers of Greene Co, MO" These records, taken from AN ILLUSTRATED HISTORICAL ATLAS MAP OF GREENE CO, MO, published in 1876 by Brink, McDonough & Co, give the patron's name, the post office at which he received his mail, the place where he was born and the year in which he came to Greene Co. Although his farm was located in Greene Co, the nearest post office may have been across the line in an adjoining county. The following symbols have been used after the town to designate the county other than Greene: *Webster, **Christian, ***Barry, ****Lawrence.The occupation is "farmer" unless otherwise stated. Often a farmer was also a carpenter, a minister, etc. The "township" and "range" also locate the property."Name, Post Ofice, Birthplace, Came to Greene Co., Twp/Rngp. 62E. J. Vaughn, Springfield, Halifax Co, VA, 1851, Twp 29, Rng 20p. 71 Beverly Vaughan, Ebenezer, Mecklenburg Co, VA, 1847, Twp 30, Rng 22p. 74A. J. Vaughan, Cave Spring, Madison Co, AR, 1863, Twp 30, Rng 23p. 80 - 1817 Taxpayers - Howard Co, MO"A list of taxable property assessed as a Territorial Tax for Howard Co. for the year 1817 by N. S. Burckhartt, Sheriff of the County. The tax book containing the original early assessment records is now in the Missouri Historical Society Library at St. Louis, MO"~~~~~~~~~~~~~~~~~~~~
Posted by PROTECT FROGS at 11:10 AM 0 comments
Labels: Calico, Callicott, Gruer, Roller Site, Vaughan's
Saturday, August 2, 2008
DNA Vaughan Ancestors
Y-DNA- The mystery of William and Fereby Vaughan has intrigued descendants for over 100 years. Several books have been written on them and their descendants. This little booklet is meant to give a brief update on research into their ancestry.For those not familiar with William and Fereby, here is a very brief biography. Both were born about 1750, though personally believe Fereby was born several years afterwards. Family tradition says William was born in Wales and lived close to Tretower Castle. According to family tradition, he came to the USA sometime before 1773 and settled in Virginia.Fereby Benton was born in North Carolina. It could be possible that she was born in Tennessee when the state was still part of North Carolina. Family tradition says that she was part Cherokee, on her mother’s side. Her father, tradition says either married the daughter of a Cherokee Chief, or was himself a Chief. Her mother was said to have been a Fereby Looney or Luna, who died in childbirth with Fereby. She was obviously named for her mother.Around 1772 William Vaughan married Fereby Benton. Their oldest known child, Thomas, was born the following year. They lived in Russell County, Virginia, then moved to Hawkins County, Tennessee. After staying there several years, they moved again, to mid Tennessee and maybe Southeast Missouri, before coming to middle Arkansas around 1821. They traveled to Arkansas with at least two of their sons and their families and several daughters with their families. Tradition says they settled somewhere around Short Mountain Creek near Paris, Arkansas, just south of the Arkansas River. They didn’t stay here long, and then moved northwest to the Boston Mountains of Northwestern Arkansas. Cane Hill and Evansville are said to have been their homes and then, once the Cherokee Indians had been moved to Oklahoma, eastward to around Hindsville, Arkansas. A mountain bordering Washington and Madison Counties is named Vaughan Mountain and a valley to the east of the Mountain is where Hindsville is located. They lived with their children during these years. On land still owned by descendants, William and Fereby are said to have been buried, though no gravestones were placed over their graves. William died sometime in the late 1830s and Fereby died in May of 1850, for her death is listed on the 1850 Madison County Death Schedule. She is listed as having died at age 105, which is at least 7 years too old.Family Tradition: Since researching ancestors before 1850 is challenging due to a less abundance of records, much of our knowledge of William and Fereby comes from Family Tradition. One tradition is that William was a Longhunter who traveled in Colonial times with the likes of fellow Longhunters such as Daniel Boone, to the Ozark Mountains, years before he moved his family there. Another legend is that Fereby’s maternal grandfather was Chief John Looney. This is ridiculous, as Chief Looney was BORN AFTER Fereby.One could spend many hours going over the traditions that have been passed down, but for this booklet, only two will be examined. First, that Fereby was part Cherokee Indian and second, that William Vaughan had a brother named John who married Nancy Callicott. Both of these traditions were given new insight by DNA testing.DNATo understand how the DNA results work, you must have a basic knowledge of genetics.Deoxyribonucleic acid (DNA) is the chemical inside the center of all cells that carries the genetic instructions for making life. DNA molecules have two strands that wrap around one another and look like a twisted ladder. The “rungs” of the letter are called bases and there are four types of chemicals that make up all types of DNA. These are Adenine, Thymine, Cytosine and Guanine (or A,T, C and G). These chemicals are attracted to each other and Adenine always pairs with Thymine and Cytosine always pairs with Guanine. The sequence of these chemicals determines everything about an individual.Chromosomes are long packages of long segments of DNA contained within the nucleus of each cell. All humans have 23 pairs of Chromosomes. In 22 pairs, both sides or parts of each pair are identical, one each coming from the father and the mother. But the 23rd pair is different. In females, this pair has two chromosomes that are called “X”. In males, this chromosome has an “X” and a “Y” which are two very different chromosomes. These Chromosomes determine a person’s sex.MtDNAThere is another type of DNA that is different from nuclear DNA. It is called Mitochondria DNA ( or MtDNA for short ). MtDNA is DNA that acts as the engine of every cell in the human body. It is not part of the “regular” type of DNA and never is mixed during reproduction. MtDNA is passed down intact from a mother to a child of either sex. Men do not pass their mother’s MtDNA to their children. Since it is not mixed during reproduction, MtDNA can be thought of as a genetic fingerprint that can show a person’s mother, maternal grandmother, great grandmother, and so on back through your mother’s line.Y-Chromosome DNAY-Chromosomes (Y-DNA for short), as mentioned above, are the Chromosomes that only males have, which makes “maleness”. As they are passed down intact from father to son, they also can be thought of as a genetic fingerprint, that can show a person’s male ancestry.How can either MtDNA and Y-DNA show a genetic link if these two types of DNA never mix with other DNA? This is due to mutations.When MtDNA or Y-DNA sets up its genetic code, it follows patterns that it setup for itself. These patterns consist of repeating orders of chemical code in each section. For example, say in “Section A” on a strand of Y-DNA, the Chemicals form an ATCGATCGATCGATCGATCG code. This is ATCG repeated 5 times. If there was a mutation, one of the repeats might be taken out or another repeat added, and the value would become 4 or 6. Then this would become the DNA value for that section of genetic code. This mutated DNA would then be passed down to the man’s male children. These mutations in repeats are not harmful and don’t really change anything noticeable. They are also very uncommon and happen completely at random.Scientists have learned that all human beings alive on earth descend from two ancestors. They gave the names of these two people (not surprisingly) Genetic Adam and Eve. All the diversity of Y-DNA and MtDNA types today are the result of mutations over the years changing the number of repeats in a person’s code. Certain groups would become isolated from other groups and so different patterns of code would occur. Today, Scientists can tell approximately where a man’s father’s male ancestors lived and where a person’s mother’s female ancestors lived by looking at the type of Y-DNA and MtDNA.The identifiable physical location on a chromosome that scientists look at is called a Locus. There are many Loci in a DNA strand, and only a few Loci are looked at. Tests range from examining 12 loci to 37 loci. Each loci is given a value as a number, which shows the number of times a pattern of chemicals repeats itself.The rate of mutation of any specific locus of DNA varies. Some loci are more likely to mutate than other loci. The average of all the rates is .002 %. This rate is not without some debate among scientists. What this rate means is, on the average, any given marker has a .002 % chance of mutating (changing the number of repeats) in any generation. If I have a value of 12 in one loci and my son has a value of 13, then that loci (assuming I’m looking at Y-DNA) has mutated. Sometime the DNA mutates more than one number, such as going from 12 to 14 at one loci. This is very uncommon, however, and most of the time, a mutation is a simple one step mutation.The rate of mutation doesn’t sound very high and in fact, it isn’t high at all. But the more markers you look at, the more likely it will be that a person will have at least one mutation. When you multiply this by many generations, you greatly increase the odds. Also, when you are comparing two people that share a common ancestor over 200 years in the past, then you have twice the chance of a mutation from that common ancestor, as there are two different lines.As a result of several years of Y-DNA and MtDNA research, a growing database of test subjects has been organized. Patterns of code based on where a person lives has developed, showing that in limited populations, specific mutations are passed down due to the lack of contact with other populations of people.Using probability math, a percentage chance that a person shares a common ancestor with another person, and the number of generations (or less) that this occurred, has been calculated.If you test 12 markers and 10 of those 12 markers match another person’s markers, you have a 50% chance that the two of you share a common ancestor 61 generations back, a 90% you share one 122 generations back and 95% chance you share one 144 generations back. For a 11 out of 12 match, it is 50% for a common ancestor 37 generations back, 90% for one 85 generations back and 9%% that there was a common ancestor 10#=3 generations back. The numbers for an exact match of 12 out of 12 goes 50% of a common ancestor 14 generations ago, 90% chance this was 48 generations ago and 95% chance it was 62 generations ago.For 25 marker tests, a 23 out of 25 match means you and the one you were tested against have a 50 % chance that you share a common ancestor 28 generations ago, a 90% it was 56 generations ago and a 9%% chance it was 66 generations ago. 24 out of 25 matches show a 50% it was 17 generations ago, 90% it was 40 generations ago and 95% it was 66 generations ago. Remember, a generation means the length of time for a child to grow up and have children. Saying this is about 20 years, then 17 generations is about 340 years.Lastly (and most importantly for our Vaughan Y-DNA study), if you have tested two people and they match 25 out of 25 loci, there is a 95% chance these two people share a common ancestor 30 generations (about 600 years) ago, 90% it was only 23 generations ago (460 years) and a 50% chance it was only 7 generations (140 years) ago. As you can see, most people want to test more loci and a better match narrows down the number of generations.Results of this studyOur first test conducted was not on Y-DNA but on MtDNA from a member of our on-line Vaughan Pioneers Group, Kim Grabbard. Kim descended through her Mom’s, Mom’s, Mom’s, Mom’s, Mom’s, Mom’s, Mom from Fereby Benton. Our test was to see if Kim and thus Fereby’s MtDNA would show that Fereby’s mother was of Indian ancestry. Native Americans have specific types of MtDNA and if this type shown up in Kim, then Fereby would have been confirmed that she was part Cherokee. As all the family traditions of Fereby say her mother was the source of her Cherokee Indian blood, we knew that if this was true, then it should show up in her MtDNA. After waiting for the test results for 6 weeks, we learned that Fereby Benton’s mother had the most common type of MtDNA from Northern Europe (Haplotype H), so Fereby’s mother couldn’t have been a pure blood Cherokee and neither was Fereby. It only shown the lack of Indian blood in one of Kim and Fereby’s ancestor, it didn’t prove anything else. Fereby’s father or her father’s father could have been Indian and since MtDNA is passed down from mother to child, she wouldn’t receive any Indian MtDNA from him. MtDNA only shows one person’s ethnic type, but if Fereby’s mother had been 100% Cherokee, she would have passed down to Fereby a Native American Haplotype. If her mother was any degree less than 100% Indian, she could have passed down a European Haplotype, but realistically, it probably shows she wasn’t Indian at all, at least on her mother’s side. I state this due to the time frame involved. Fereby was born about 1750. Her mother would have been born no later than the mid 1730s. If her mother wasn’t at least half Indian, then the timeframe would make it more difficult for her to have an Indian ancestor, due to more limited intermarriage with the Cherokee Indians before the 1730s. However, if Fereby’s mother was half Indian – her mother a white woman and her father a Cherokee (or some other tribe), then Fereby’s mother would have received white MtDNA from her white mother and in turn passed it down to Fereby. So Fereby could have been a quarter Indian and still have white MtDNA.William and JohnIn 2004, we decided to try a test on a descendant of William Vaughan and a descendant of John Vaughan. John Vaughan is a name that pops up often when looking over William and Fereby’s ancestry. He first shows up as a Revolutionary War soldier, serving in the Maryland Artillery. He achieves the rank of Sergeant and after his discharge, moves to Virginia. It is in Charlotte County that he meets 14 year old Nancy Callicott. Though he is 15 years older than her, they fall in love and try to marry in October of 1792, but apparently her father would not allow it. So they wait until she turns 17 and they elope to Halifax County and are married there. Here they stay until 1798 when they move to Hawkins County, Tennessee. The land they buy in Hawkins County was near land owned by William and Fereby and years later as they are preparing to move west to central Tennessee, William sells land which is resold to John and Nancy. John and Nancy’s son James marries William and Fereby’s daughter Martha. James and Martha move west with William and Fereby and pass down a tradition that they (James and Martha) were
...[Message clipped] View entire message
20 attachments — Download all attachments View all images THIS MAY NOT BE POSSIBLE...TOO SMALL, BUT YOU CAN GO TO THE PAGES AND COPY FROM THERE.
image011.jpg1K View Download
image012.jpg1K View Download
image013.jpg2K View Download
image014.jpg1K View Download
image015.jpg1K View Download
image016.jpg1K View Download
image017.jpg1K View Download
image018.jpg1K View Download
image019.jpg1K View Download
image020.jpg1K View Download
image021.jpg1K View Download
image022.jpg1K View Download
image023.jpg1K View Download
image024.jpg1K View Download
image025.jpg1K View Download
image026.jpg1K View Download
image027.jpg1K View Download
image028.jpg1K View Download
image029.jpg1K View Download
image030.png1K View Download
http://www.findagrave.com/cgi-bin/fg.cgi?page=gr&GRid=13190489 Images of John Franklin Vaughan grave and etc.
 
 
 
 
No comments:
Post a Comment